View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_111 (Length: 226)
Name: NF19266_high_111
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_111 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 213
Target Start/End: Original strand, 3814995 - 3815199
Alignment:
| Q |
12 |
aacataggttttgaatgtcaaaat---accaccatgtttgaaaaatattgtttttcaaaaaattaagaaacaaaacatctaaattgagtgattgccctgg |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3814995 |
aacataggttttgaatgtcaaaatgacaccaccatgtttgaaaaatattgtttttcaaaagattaagaaacaaaacatctaaattgagtgattgccctgg |
3815094 |
T |
 |
| Q |
109 |
atggcgataaaaatagatctagatttcacgcatctaatgagaaacacgataatgaattttagttatctaaccttatataaattctacaatttaaatgatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3815095 |
atggcgataaaaatagatctagatttcacgcatctaatgagaaacacgataatgaattttagctatctaaccttatataaattctacaatttaaatgatg |
3815194 |
T |
 |
| Q |
209 |
atttt |
213 |
Q |
| |
|
||||| |
|
|
| T |
3815195 |
atttt |
3815199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University