View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19266_high_111 (Length: 226)

Name: NF19266_high_111
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19266_high_111
NF19266_high_111
[»] chr2 (1 HSPs)
chr2 (12-213)||(3814995-3815199)


Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 213
Target Start/End: Original strand, 3814995 - 3815199
Alignment:
12 aacataggttttgaatgtcaaaat---accaccatgtttgaaaaatattgtttttcaaaaaattaagaaacaaaacatctaaattgagtgattgccctgg 108  Q
    ||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
3814995 aacataggttttgaatgtcaaaatgacaccaccatgtttgaaaaatattgtttttcaaaagattaagaaacaaaacatctaaattgagtgattgccctgg 3815094  T
109 atggcgataaaaatagatctagatttcacgcatctaatgagaaacacgataatgaattttagttatctaaccttatataaattctacaatttaaatgatg 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
3815095 atggcgataaaaatagatctagatttcacgcatctaatgagaaacacgataatgaattttagctatctaaccttatataaattctacaatttaaatgatg 3815194  T
209 atttt 213  Q
    |||||    
3815195 atttt 3815199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University