View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_113 (Length: 221)
Name: NF19266_high_113
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_113 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 13138483 - 13138296
Alignment:
| Q |
17 |
tatgaatctttctacaatatgccatagccactactcattaaaaaattctaccatacatgtacctgctctttggaatttacattctatatgcccaaggtaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
13138483 |
tatgaatctttctacaatatgccatagccactactcattaaaaaattctaccatacatgtacctgttctttagaatttacattgtatatgccctaggtaa |
13138384 |
T |
|
| Q |
117 |
ttatataataaggtgggaaaaaatataaacgctcaaaacaaactctatagacattcatggttttcttctagctacgaacgtcgatcct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13138383 |
ttatataataaggtgggaaaaaatataaacgctcaaaacaaactctatagacattcatggttttcttctagctacgaacgtcgatcct |
13138296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University