View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_119 (Length: 206)
Name: NF19266_high_119
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_119 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 29451569 - 29451386
Alignment:
| Q |
1 |
aggagagattggtggctgcttttattgctgtccagttggagtctgagcttcggtgaggacggcggatgacagcggatgagacggtgtctccggcggtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451569 |
aggagagattggtggctgcttttattgctgtccagttggagtctgagcttcggtgaggacggcggatgacagcggatgagacggtgtctccggcggtgga |
29451470 |
T |
|
| Q |
101 |
ggcggttgagagacggtcgttgaaactaagagcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcg |
184 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451469 |
ggcggtggagagacggtcgttgaaactaagagcaaggctgcttgttcgggctaagctggtgcgtgctgaggaggtgaaggtgcg |
29451386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University