View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_33 (Length: 375)
Name: NF19266_high_33
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 357
Target Start/End: Original strand, 34820936 - 34821292
Alignment:
| Q |
1 |
gccgtcgtttaccgttatcaactttgttccatgcataatcaaatgtctcgagcatttgagattttactttacaagcttcaccatcggtcttcatctgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34820936 |
gccgtcgtttaccgttatcaactttgttccatgcataatcaaatgtctcgagcatttgagattttactttacaagcttcaccatcggtcttcatctgttc |
34821035 |
T |
|
| Q |
101 |
aacaaatagtattgcgcaaataaatcattgaaattaaaaatatttgcaaatcatttgtttaagataaaattttacttgtcttccctaaatgcaagacttg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34821036 |
aacaaatggtattgcgcaaataaatcattgaaattaaaaatatttgcaaatcatttgtttaagataaaattttacttgtcttccctaaatgcaagacttg |
34821135 |
T |
|
| Q |
201 |
atatcaattaattgtgtaaattatttccacaaacatcattagagatcattgcttaacatttactatggtctgttaggtacgtaatggattaactcataac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34821136 |
atatcaattaattgtgtaaattatttccacaaacatcattagagatcattgcttaacatttactatggtctgttaggtacgtaatggattaactcataac |
34821235 |
T |
|
| Q |
301 |
tagagacaatacttatttgatttcataattatcaacaatcatggactttgtgatatt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34821236 |
tagagacaatacttatttgatttcataattatcaacaatcatggactttgtgatatt |
34821292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University