View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_62 (Length: 290)
Name: NF19266_high_62
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 23 - 277
Target Start/End: Original strand, 26881298 - 26881552
Alignment:
| Q |
23 |
catcgtatacaaggagcccccttaaccatatatgcattgggaatttggaccaattatcatgtgaatatttatcaaccttcaatttttagacaaggtcttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881298 |
catcgtatacaaggagcccccttaaccatatatgcattgggaatttggaccaattatcatgtgaatatttatcaaccttcaatttttagacaaggtcttc |
26881397 |
T |
 |
| Q |
123 |
attgattcaaattagatatacgtacaagaaaatgtgtaattactaattagtggcattcacactacttagtcaagaactgtctattatccttctttgtctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881398 |
attgattcaaattagatatacgtacaagaaaatgtgtaattactaattagtgacattcacactacttagtcaagaactgtctattatccttctttgtctt |
26881497 |
T |
 |
| Q |
223 |
atgagaaatattataatttttcaataactaaagcactttccacatatgtgtcttc |
277 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26881498 |
atgagaaatattataatttttccataactaaagcactttccacatatgtgtcttc |
26881552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University