View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_78 (Length: 256)
Name: NF19266_high_78
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 4869315 - 4869097
Alignment:
| Q |
17 |
cacagacgttagtatagtaatgatacttgttagccatatccaacctccttttggagccatgttttcaaactcttccatttcattatcttcaaccaaattc |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4869315 |
cacaaacgttagtatagtaatgatacttgttagccatatccaacctccttttggagccatgttttcaaactcttccatttcatcatcttcaaccaaattc |
4869216 |
T |
 |
| Q |
117 |
atcacttcaatctctccacaacaattcttcaataatcaaccacctaaattcaacaccataagaaccttcattaaacccttgcatcttacactagccaaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4869215 |
atcacttcaatctctccacaacaattcttcaataatcaaccacctaaattcaacaccataagaaccttcattaaacccttgcatcttacactagccaaag |
4869116 |
T |
 |
| Q |
217 |
ctgaaggaaacatagactc |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4869115 |
ctgaaggaaacatagactc |
4869097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University