View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_82 (Length: 254)
Name: NF19266_high_82
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_82 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 49 - 236
Target Start/End: Original strand, 54452774 - 54452961
Alignment:
| Q |
49 |
attagttcaaaatttcttaattttgatataaattgggtatgacttttaagaattccaattatatattttagttagtatttgtcgcaatcccaatattttg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
54452774 |
attagttcaaaatttcttaattttgatataaattgggtatgacttttaagaattccagttatatattttagttagtatttgtcgcaaccccaatattttg |
54452873 |
T |
|
| Q |
149 |
ggtaagattcgtcagtgaccatatcatgtttctatcttattgtacgtaccaaatcgactctaaaaagtgtcattattagcaggatata |
236 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
54452874 |
ggtaagattcgtcaatgaccatatcatgtttctatcttattgtacataccaaatggactctaaaaagtgtctttattagccggatata |
54452961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 85 - 156
Target Start/End: Original strand, 28467770 - 28467843
Alignment:
| Q |
85 |
gtatgacttttaagaattccaattata-tattttagttagtatttgtcgcaat-cccaatattttgggtaagat |
156 |
Q |
| |
|
|||| ||||||| ||||| |||||||| ||||||||||| |||||||||| | ||||||||||||| |||||| |
|
|
| T |
28467770 |
gtataacttttatgaatttcaattataatattttagttaatatttgtcgctctccccaatattttggataagat |
28467843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 156
Target Start/End: Complemental strand, 7700975 - 7700930
Alignment:
| Q |
111 |
atattttagttagtatttgtcgcaatcccaatattttgggtaagat |
156 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
7700975 |
atattttagttagtatttgtcgctcccccaatattttgggcaagat |
7700930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University