View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_92 (Length: 245)
Name: NF19266_high_92
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 43803144 - 43803066
Alignment:
| Q |
10 |
ttataaacaaaggaaacaaatagaaaa-gtgattctcattactcaattatggaaagtacaagatgtatatatacatgaa |
87 |
Q |
| |
|
|||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43803144 |
ttatgaacaaaagaaacaaatagaaaaagtgattctcattactcaattatggaaagtacaagatgtatatatacatgaa |
43803066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 27767576 - 27767633
Alignment:
| Q |
103 |
gatatttgatggctataagaatgtgatacccctttttgattctctatcacaaatttct |
160 |
Q |
| |
|
||||||||||||||||| |||| |||||| || |||||||||||||| ||||||||| |
|
|
| T |
27767576 |
gatatttgatggctatatgaatatgatacgccattttgattctctatttcaaatttct |
27767633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University