View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_high_98 (Length: 239)
Name: NF19266_high_98
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_high_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 93 - 154
Target Start/End: Complemental strand, 43338030 - 43337969
Alignment:
| Q |
93 |
atattgtgtgaccttttttaaattcaatcatagtactcatttggaccgtgctgtggtcaatg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43338030 |
atattgtgtgaccttttttaaattcaatcatagtactcatttggaccgtggtgtggtcaatg |
43337969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 43338099 - 43338048
Alignment:
| Q |
18 |
atgataatctttcttcagctgtggatgagctctttagaggactccttaaagg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43338099 |
atgataatctttcttcagctgtggatgacctctttagaggactccttaaagg |
43338048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 185 - 239
Target Start/End: Complemental strand, 43337928 - 43337874
Alignment:
| Q |
185 |
ggtcaattttgttctccaaacaaattttcttctaatgcaaaaattctaatttgac |
239 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43337928 |
ggtcaattttgttcaccaagcaaattttcttctaatgcaaaaattctaatttgac |
43337874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University