View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19266_low_102 (Length: 239)

Name: NF19266_low_102
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19266_low_102
NF19266_low_102
[»] chr2 (3 HSPs)
chr2 (93-154)||(43337969-43338030)
chr2 (18-69)||(43338048-43338099)
chr2 (185-239)||(43337874-43337928)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 93 - 154
Target Start/End: Complemental strand, 43338030 - 43337969
Alignment:
93 atattgtgtgaccttttttaaattcaatcatagtactcatttggaccgtgctgtggtcaatg 154  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
43338030 atattgtgtgaccttttttaaattcaatcatagtactcatttggaccgtggtgtggtcaatg 43337969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 43338099 - 43338048
Alignment:
18 atgataatctttcttcagctgtggatgagctctttagaggactccttaaagg 69  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||    
43338099 atgataatctttcttcagctgtggatgacctctttagaggactccttaaagg 43338048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 185 - 239
Target Start/End: Complemental strand, 43337928 - 43337874
Alignment:
185 ggtcaattttgttctccaaacaaattttcttctaatgcaaaaattctaatttgac 239  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||||||||    
43337928 ggtcaattttgttcaccaagcaaattttcttctaatgcaaaaattctaatttgac 43337874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University