View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_low_120 (Length: 214)
Name: NF19266_low_120
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_low_120 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 14085269 - 14085065
Alignment:
| Q |
1 |
tcttttactcttttaggttaatattggtttagcatt---gttttaactttgtatttgatttagtctatgtttactctgttttgatagttgtctttgattt |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14085269 |
tcttttactcttttagggtaatattggtttagcatttttgttttaactttgtatttgatttagtctatgtttactctgttttgatagttgtctttgattt |
14085170 |
T |
|
| Q |
98 |
tagtttgctatactgtcatattttatggctttgatttgttagttactaatgtatattttctttannnnnnnnnaacaggttaacaaatattctttctgtg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14085169 |
tagtttgctatactgtcatattttatggctttgatttgttagttactaatgtatattttctttatttttttttaacaggttaacaaatattctttctgtg |
14085070 |
T |
|
| Q |
198 |
ctgct |
202 |
Q |
| |
|
|||| |
|
|
| T |
14085069 |
atgct |
14085065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 41 - 156
Target Start/End: Original strand, 12190142 - 12190254
Alignment:
| Q |
41 |
taactttgtatttgatttagtctatgtttactctgttttgatagttgtctttgattttagtttgctatactgtcatattttatggctttgatttgttagt |
140 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| ||||| ||| |||||||||| ||||||||| || ||| ||||||| |||||||||||| |||| |
|
|
| T |
12190142 |
taactttgtatttgatttagtctattttaactctattttggtagatgtctttgatgttagtttgc--tagtgttatattttgtggctttgatttattag- |
12190238 |
T |
|
| Q |
141 |
tactaatgtatatttt |
156 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12190239 |
tactaatgtatatttt |
12190254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University