View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_low_121 (Length: 213)
Name: NF19266_low_121
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_low_121 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 32896201 - 32896380
Alignment:
| Q |
20 |
atactcactcgttcctcgaatatgaacaattaaaagagtgnnnnnnntagattaattttcatacaccgccagtataaaaagatttgtcaaaattacagtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32896201 |
atactcactcgttcctcgaatatgaacaattaaaagggtgaaaaaaatagattaattttcatacaccgccggtataaaaagatttgtcaaaattacagtg |
32896300 |
T |
|
| Q |
120 |
agtcgcggtgaataaaataaatactctcttattcctcgaatattaacaataaaaaaggaaaatgtttcataacattatat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32896301 |
agtcgcggtgaataaaataaatactctcttattcctcgaatattaacaataaaaaaggaaaatgtttcataacattatat |
32896380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University