View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_low_21 (Length: 446)
Name: NF19266_low_21
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 401; Significance: 0; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 18 - 433
Target Start/End: Complemental strand, 53425622 - 53425204
Alignment:
| Q |
18 |
tctctcacataaatcgagtcaagccaacctgttatatcctatacattatttctatgtttacgcttatgaggtccattagaataaaagctgccatgaattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425622 |
tctctcacataaatcgagtcaagccaacctgttatatcccatacattatttctatgtttacgcttatgaggtccattagaataaaagctgccatgaattt |
53425523 |
T |
 |
| Q |
118 |
gtttttctatttttaggaagataataggagcaaggtattacgctgatcctgatgagtacgatga---aacggagaacacggtaagggatagaaatggaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
53425522 |
gtttttctatttttaggaagataataggagcaaggtattacgctgatcctgatgagtacgatgatgaaacggagaacacggtaagggatagaaatggaca |
53425423 |
T |
 |
| Q |
215 |
tgggacccacacagcttcaacggctgcagggaactttgtgagtggtgcatcatattatgatctcgcggcagggacagcaaaaggtgggtctcctgaatcg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425422 |
tgggacccacacagcttcaacggctgcagggaactttgtgagtggtgcatcatattatgatctcgcggcagggacagcaaaaggtgggtctcctgaatcg |
53425323 |
T |
 |
| Q |
315 |
aggttggcaatttacaaagtgtgctctcctggctgttctggctctggcatgcttgctgcattcgacgatgccatttatgatggagttgatgtactttcac |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425322 |
aggttggcaatttacaaagtgtgctctcctggctgttctggctctggcatgcttgctgcattcgacgatgccatttatgatggagttgatgtactttcac |
53425223 |
T |
 |
| Q |
415 |
tctcaattggtccatattc |
433 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53425222 |
tctcaattggtccatattc |
53425204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 189 - 406
Target Start/End: Complemental strand, 53309438 - 53309221
Alignment:
| Q |
189 |
aacacggtaagggatagaaatggacatgggacccacacagcttcaacggctgcagggaactttgtgagtggtgcatcatattatgatctcgcggcaggga |
288 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||| ||||| || || || |||||||| | ||||||||||||||||| |||| ||| || | ||||| |
|
|
| T |
53309438 |
aacacggtaagggatacatatggacatggtacccatacagcatcgacagcagcagggaatgtcgtgagtggtgcatcatactatggtcttgcagaaggga |
53309339 |
T |
 |
| Q |
289 |
cagcaaaaggtgggtctcctgaatcgaggttggcaatttacaaagtgtgctctcctggctgttctggctctggcatgcttgctgcattcgacgatgccat |
388 |
Q |
| |
|
|||||||||||||||| |||| |||||||| || |||||||||||||| | |||| ||||| ||||||||| || ||||| || |||||| ||||||| |
|
|
| T |
53309338 |
cagcaaaaggtgggtcctctgagtcgaggttagcgatttacaaagtgtgatttccttcctgttatggctctgggatccttgcagcgttcgacaatgccat |
53309239 |
T |
 |
| Q |
389 |
ttatgatggagttgatgt |
406 |
Q |
| |
|
|| |||||||| ||||| |
|
|
| T |
53309238 |
tttcgatggagtagatgt |
53309221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 208 - 418
Target Start/End: Complemental strand, 53432570 - 53432360
Alignment:
| Q |
208 |
atggacatgggacccacacagcttcaacggctgcagggaactttgtgagtggtgcatcatattatgatctcgcggcagggacagcaaaaggtgggtctcc |
307 |
Q |
| |
|
|||| ||||| ||||||||||| || || || || ||||| ||||||||||||||||||| | || ||| ||||||||||| ||||||| ||||| || |
|
|
| T |
53432570 |
atggtcatggaacccacacagcatcgaccgcggctgggaatgttgtgagtggtgcatcatactttggtcttgcggcagggacgacaaaaggcgggtcccc |
53432471 |
T |
 |
| Q |
308 |
tgaatcgaggttggcaatttacaaagtgtgctctcctggctgttctggctctggcatgcttgctgcattcgacgatgccatttatgatggagttgatgta |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||| | || || ||||| | ||| ||||| |||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
53432470 |
tgaatcgaggttggcaatttacaaagtgtgcaatatgttttgctcaggctcggccatccttgcggcattcgatgatgcaatttctgatggagttgatgtg |
53432371 |
T |
 |
| Q |
408 |
ctttcactctc |
418 |
Q |
| |
|
||||||||||| |
|
|
| T |
53432370 |
ctttcactctc |
53432360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 252 - 418
Target Start/End: Original strand, 48372155 - 48372324
Alignment:
| Q |
252 |
gtgagtggtgcatcatattatgatctcgcggcagggacagcaaaaggtgggtctcctgaatcgaggttggcaatttacaaagtgt---gctctcctggct |
348 |
Q |
| |
|
||||||||||||||||| |||| |||||||| ||||| |||||||||||| || ||||||||||||||||| ||||||||||||| || | ||| | |
|
|
| T |
48372155 |
gtgagtggtgcatcatactatggtctcgcggaagggatagcaaaaggtggttcccctgaatcgaggttggcgatttacaaagtgtgcagcaatattggtt |
48372254 |
T |
 |
| Q |
349 |
gttctggctctggcatgcttgctgcattcgacgatgccatttatgatggagttgatgtactttcactctc |
418 |
Q |
| |
|
| |||||||||| ||| ||||| || || |||||||| |||| ||||||||||||||| ||||| ||||| |
|
|
| T |
48372255 |
gctctggctctgccatacttgcggcgtttgacgatgcaatttctgatggagttgatgtgctttcgctctc |
48372324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 208 - 418
Target Start/End: Complemental strand, 26097946 - 26097736
Alignment:
| Q |
208 |
atggacatgggacccacacagcttcaacggctgcagggaactttgtgagtggtgcatcatattatgatctcgcggcagggacagcaaaaggtgggtctcc |
307 |
Q |
| |
|
|||| ||||| ||||||||||| ||||| || || |||||| | ||||||||||||||||| | || ||| || ||||| || ||||||||||| || || |
|
|
| T |
26097946 |
atgggcatggaacccacacagcgtcaaccgcggcggggaacgtcgtgagtggtgcatcatactttggtcttgcagcaggaacggcaaaaggtggatcccc |
26097847 |
T |
 |
| Q |
308 |
tgaatcgaggttggcaatttacaaagtgtgctctcctggctgttctggctctggcatgcttgctgcattcgacgatgccatttatgatggagttgatgta |
407 |
Q |
| |
|
| ||| |||||| ||||||||||||||||| ||| || |||||||||| ||| ||||| || ||||||||||| |||| ||| ||||||||| || |
|
|
| T |
26097846 |
cggatcaaggttgtcaatttacaaagtgtgcaactttggttgctctggctctgccatccttgcggctttcgacgatgcaatttctgacggagttgatata |
26097747 |
T |
 |
| Q |
408 |
ctttcactctc |
418 |
Q |
| |
|
|||||| |||| |
|
|
| T |
26097746 |
ctttcagtctc |
26097736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 254 - 341
Target Start/End: Complemental strand, 53321155 - 53321068
Alignment:
| Q |
254 |
gagtggtgcatcatattatgatctcgcggcagggacagcaaaaggtgggtctcctgaatcgaggttggcaatttacaaagtgtgctct |
341 |
Q |
| |
|
||||||||||||||| || | ||| || ||||||| ||||||| ||||||||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
53321155 |
gagtggtgcatcatactacggtcttgcaaaagggacatcaaaaggggggtctcctcaatcaaggttggcgatttacaaagtgtgctct |
53321068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 26098034 - 26098002
Alignment:
| Q |
126 |
atttttaggaagataataggagcaaggtattac |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26098034 |
atttttaggaagataataggagcaaggtattac |
26098002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 129 - 158
Target Start/End: Original strand, 48372032 - 48372061
Alignment:
| Q |
129 |
tttaggaagataataggagcaaggtattac |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48372032 |
tttaggaagataataggagcaaggtattac |
48372061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 171
Target Start/End: Complemental strand, 53309501 - 53309456
Alignment:
| Q |
126 |
atttttaggaagataataggagcaaggtattacgctgatcctgatg |
171 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || | ||||||| |
|
|
| T |
53309501 |
atttttaggaagataatcggagcaaggtattaccctaaccctgatg |
53309456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 53432652 - 53432620
Alignment:
| Q |
126 |
atttttaggaagataataggagcaaggtattac |
158 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
53432652 |
atttttaggaagataataggagcaagatattac |
53432620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 406
Target Start/End: Complemental strand, 140342 - 140302
Alignment:
| Q |
366 |
cttgctgcattcgacgatgccatttatgatggagttgatgt |
406 |
Q |
| |
|
||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
140342 |
cttgctgcatttgatgatgccattgatgatggagttgatgt |
140302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University