View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_low_72 (Length: 263)
Name: NF19266_low_72
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_low_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 37108267 - 37108521
Alignment:
| Q |
1 |
tttggtccatcattgccagcagagcaaacaacaacaatacctttcttagcagcatggaaagatccaatagcaacactatcattgaaaaggttagaagcag |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108267 |
tttggtccactattgccagcagagcaaacaacaacaatacctttcttagcagcatggaaagatccaatagcaacactatcattgaaaaggttagaagcag |
37108366 |
T |
|
| Q |
101 |
agccaccaagtgacacagacaagacatcaacaccatcatggatagctgcatcaaatgctgcaagtatgtctgcatcaaagcactcgtcgccattaattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108367 |
agccaccaagtgacacagacaagacatcaacaccatcatggatagctgcatcaaatgctgcaagtatgtctgcatcaaagcactcgtcgccattaattgg |
37108466 |
T |
|
| Q |
201 |
aggccaacaaactttgtatgatgcaactcttgcttttggtgaaccaccctttgct |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108467 |
aggccaacaaactttgtatgatgcaactcttgcttttggtgaaccaccctttgct |
37108521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 39188879 - 39188767
Alignment:
| Q |
124 |
acatcaacaccatcatggatagctgcatcaaatgctgcaagtatgtctgcatcaaagcactcgtcgccattaattggaggccaacaaactttgtatgatg |
223 |
Q |
| |
|
|||||||| |||||||| ||||| |||||| ||||| | || || ||||||||||| ||| ||||| |||||| ||||| || |||||||| | | |
|
|
| T |
39188879 |
acatcaaccccatcatgaatagccatatcaaaggctgccatgatatcagcatcaaagcattcgctgccatcaattggtggccagcagactttgtaagcag |
39188780 |
T |
|
| Q |
224 |
caactcttgcttt |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39188779 |
caactcttgcttt |
39188767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University