View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19266_low_97 (Length: 243)
Name: NF19266_low_97
Description: NF19266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19266_low_97 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 34142119 - 34141875
Alignment:
| Q |
1 |
cctcttgattcacc--aagtaatcatctcagttataatttcaggtgaaaagaagaaaatgccaatggaaatgactcccaatttgttcatttgcaatgaaa |
98 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142119 |
cctcttgattcccccgaagtaatcatctcagttataatttcaggtgtaaagaagaaaatgccaatggaaatgactcccaatttgttcatttgcaatgaaa |
34142020 |
T |
 |
| Q |
99 |
aattgaatgcaacaggtatgtttatcattattattacatgtggcttcatgcaattgtatgcgcttacattaaccttttgattgcagggccgccagagatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142019 |
aattgaatgcaacaggtatgtttatcattattattacatgtggcttcatgcaattgtacgcgcttacattaaccttttgattgcagggccgccagagatt |
34141920 |
T |
 |
| Q |
199 |
attattaagaaagagtataatgaagatgaaactgtgacctctgtg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34141919 |
attattaagaaagagtataatgaagatgaaactgtgacctgtgtg |
34141875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University