View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_high_14 (Length: 453)
Name: NF19267_high_14
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 24038859 - 24038911
Alignment:
| Q |
8 |
tgatatgaattatgtattgtatgaatttgaaatttcctttaattagattagtc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24038859 |
tgatatgaattatgtattgtatgaatttgaaatttcctttaattatattagtc |
24038911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 397 - 435
Target Start/End: Original strand, 24039077 - 24039115
Alignment:
| Q |
397 |
ggtgtagatgcaaatcttcgtcaaaactcttactggcaa |
435 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
24039077 |
ggtgtagatgcaaatattcgtcaagactcttactggcaa |
24039115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University