View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_high_38 (Length: 337)
Name: NF19267_high_38
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 319
Target Start/End: Complemental strand, 55310529 - 55310210
Alignment:
| Q |
7 |
tcgagtgagatgaaaacgatccttggcggccag------aaaccattcatacaattcgtggnnnnnnnctcttctttataagcatacaatttgtggttct |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55310529 |
tcgagggagatgaaaacgatccttggcggccagggccagaaaccattcatacaattcgtggttttttcttcttctttataagcatacaatttgtggttct |
55310430 |
T |
 |
| Q |
101 |
gtttattccccgtttcattcatatttct-tattttctttcccatccaactttacatttttcccttatttcagctcaagcctatgcttaccatcaaacagg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55310429 |
gtttattccccgtttcattcatatttctctattttctttcccatccaactttacattttttccttatttcagctcaagcctatgcttaccatcaaacagg |
55310330 |
T |
 |
| Q |
200 |
tataccatccctcttccttatgtttttatatctttgttatatttctcttaatag-taaaccacttctttctattaattcatttcttggttatttttgaag |
298 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55310329 |
tatatcatccctcttccttatgtttttatatctttgttatatttctcttaatagttaaaccacttctttctattaattcatttcttggtta-ttttgaag |
55310231 |
T |
 |
| Q |
299 |
ggagcaatatcatattatatc |
319 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
55310230 |
ggagcaatatcatattatatc |
55310210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University