View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_high_56 (Length: 270)
Name: NF19267_high_56
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_high_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 29116324 - 29116571
Alignment:
| Q |
9 |
agcaaaggggtaatcattctatatctttatgtaaatgattttcttatcacatgtagcaatggatcttacataaacgactttaagaatgatttgatgaagg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29116324 |
agcaaaggggtaatcattctatatctttatgtaaatgattttcttatcacatgtagcaatggatcttacataaacgaatttaagaatgatttgatgaagg |
29116423 |
T |
 |
| Q |
109 |
aatttgagatggttgatctacttcacatctcatatttccttgccatggagtttcaaagaacaagtagggcttctaattcatcaaaagag--atatgctag |
206 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29116424 |
aatttgagatggttgatctaggtcacatttcatatttccttcgcatggagtttcaaagaacaagtagggcttctaattcatcaaaagagatatatgctag |
29116523 |
T |
 |
| Q |
207 |
tgaaattcttaaaaggttttagatggagtattgaaatcttgatgtaac |
254 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
29116524 |
tgaaattcttaaaaggttttagatggaatattgcaatcttgatgtaac |
29116571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University