View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_high_65 (Length: 242)
Name: NF19267_high_65
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 41090685 - 41090890
Alignment:
| Q |
16 |
atgaaaacgtgtgagaagcttgaaagattgaaactttgaggtaaagggtattgtaaaagaaggtttgttttgatgggttttgttgtgtgtaggtgtttga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090685 |
atgaaaacgtgtgagaagcttgaaagattgaaactttgaggtaaagggtattgtaaaagaaggtttgttttgatgggttttgttgtgtgtaggtgtttga |
41090784 |
T |
 |
| Q |
116 |
gatggtgatgatggagtgttgcttgagaagcgttgttcatggtgaaaatgatgaggagaaggtgaagaaaaaggtgtaacttggattgagaaatgggtga |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090785 |
gaaggtgatgatggagtgttgcttgagaagcgttgttcatggtgaaaatgatgaggagaaggtgaagaaaaaggtgtaacttggattgagaaatgggtga |
41090884 |
T |
 |
| Q |
216 |
aatcgg |
221 |
Q |
| |
|
|||||| |
|
|
| T |
41090885 |
aatcgg |
41090890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University