View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_high_76 (Length: 222)
Name: NF19267_high_76
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_high_76 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 36 - 206
Target Start/End: Complemental strand, 31058739 - 31058569
Alignment:
| Q |
36 |
aatttctagttgtgaaactgaaatcaggggttatgtgtgttgacaatgacgcaatacatcccaagtttgaagtcatgccacacagagaaatgtcatcggc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058739 |
aatttctagttgtgaaactgaaatcaggggttatgtgtgttgacaatgactcaatacatcccaagtttgaagtcatgccacacagagaaatgtcatcggc |
31058640 |
T |
|
| Q |
136 |
ctaggaaaattcatgaagtggttttctttctcgcgctttactgtaaatctttcggaactggaggatacaga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058639 |
ctaggaaaattcatgaagtggttttctttctcgcgctttactgtaaatctttcggaactggaggatacaga |
31058569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 75 - 180
Target Start/End: Complemental strand, 31082591 - 31082486
Alignment:
| Q |
75 |
ttgacaatgacgcaatacatcccaagtttgaagtcatgccacacagagaaatgtcatcggcctaggaaaattcatgaagtggttttctttctcgcgcttt |
174 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||||| ||||| ||| ||||| || ||| ||||||||||||||||| |||||||| || || |||| |
|
|
| T |
31082591 |
ttgacaatgtctcaatacatcccaagtttaaagtcatgcaacacaaagacatgtcttcagccaaggaaaattcatgaagttgttttcttccttgcccttt |
31082492 |
T |
|
| Q |
175 |
actgta |
180 |
Q |
| |
|
|||||| |
|
|
| T |
31082491 |
actgta |
31082486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University