View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19267_low_14 (Length: 453)

Name: NF19267_low_14
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19267_low_14
NF19267_low_14
[»] chr6 (2 HSPs)
chr6 (8-60)||(24038859-24038911)
chr6 (397-435)||(24039077-24039115)


Alignment Details
Target: chr6 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 24038859 - 24038911
Alignment:
8 tgatatgaattatgtattgtatgaatttgaaatttcctttaattagattagtc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||    
24038859 tgatatgaattatgtattgtatgaatttgaaatttcctttaattatattagtc 24038911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 397 - 435
Target Start/End: Original strand, 24039077 - 24039115
Alignment:
397 ggtgtagatgcaaatcttcgtcaaaactcttactggcaa 435  Q
    ||||||||||||||| |||||||| ||||||||||||||    
24039077 ggtgtagatgcaaatattcgtcaagactcttactggcaa 24039115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University