View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_42 (Length: 322)
Name: NF19267_low_42
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 31572792 - 31573073
Alignment:
| Q |
1 |
cagtgagtttcttaatccaataactcatgaagttattttgagtaactcaaggtgtgagttaaaaatcactggttttcaagaagggattaacaatggtggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31572792 |
cagtgagtttcttaatccaataactcatgaagttattttgagtaactcaaggtgtgagttaaaaatcactggttttcaagaagggattaacggtggtggt |
31572891 |
T |
 |
| Q |
101 |
aataatgctagtggtggtagtagtagtggtggttcttcaacttatgttggtactttaagacctggtacacctggtcctggaggacaccctacaatgcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31572892 |
aataatgctagtggtggtagtagtagtggtggttcttcaacttatgttggtactttaagacctggtacacctggtcctggaggacaccctacaatgcatt |
31572991 |
T |
 |
| Q |
201 |
actttaacccttcttttaggacttcttcaactcctccaaggaaatctccttttcttttgtcagaagggtctaatggttttca |
282 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31572992 |
actttaacccttcttttagaacttcttcaactcctccaaggaaatctccttttcttttgtcagaagggtctaatggttttca |
31573073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University