View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_50 (Length: 291)
Name: NF19267_low_50
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 82 - 275
Target Start/End: Complemental strand, 14220657 - 14220464
Alignment:
| Q |
82 |
taatatatttgtcaaaactagcgcgcttataaagtgcttatgtcgggaatttccaatatgtcgaacacaaagattgcaaaagcttggtataaagatatac |
181 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14220657 |
taatatacttgtcaaaactagcgcgcttataaagtgcttatgtcgggaatttccaatatgtcgaacacaaagattgcaaaagcttggcataaagatatac |
14220558 |
T |
 |
| Q |
182 |
ttccaaaagttgcaattttcgtttggatgttattccaaaacaaaattgcaatgaaggaaaacctttgcaaaagatgagtccttgatcaaaattt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14220557 |
ttccaaaagttgcaattttcgtttggatgttattccaaaacaaaattgcaatgaaggaaaacctttgcaaaagatgagtccttgatcaaaattt |
14220464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 14220767 - 14220655
Alignment:
| Q |
1 |
cttaagttgttgtgtttaccctgtataatcagtaagagctgaacattttagagttttatagcctttttcccctagaggtggtaatatatttgtcaaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14220767 |
cttaagttgttgtgtttaccctgtataatcagtaagagctgaacattttagagttttatagcctttttcccctagaggtgataatatatttgtcaaaact |
14220668 |
T |
 |
| Q |
101 |
agcgcgcttataa |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14220667 |
agcgcgcttataa |
14220655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University