View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_63 (Length: 249)
Name: NF19267_low_63
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 232
Target Start/End: Original strand, 38101041 - 38101259
Alignment:
| Q |
15 |
aatataatagtgttaagaacttgaaattgtgag-aattatgaatcacttgcttctatatattcttgatacttgacataccttcatattaccagctcttct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101041 |
aatataatagtgttaagaacttgaaattgtgaggaattatgaatcacttgcttctatatattcttgatacttgacataccttcatattaccagctcttct |
38101140 |
T |
 |
| Q |
114 |
tccaaatttctcagttaggacccctaaagaatcgatgattccaactggtacaggtgctggcctattgatatcatcaaaagcctctttgatacgaacacaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38101141 |
tccaaatttctcagttaggacccctaaagaatcgatgattccaactggtacaggtgctggcctattgataccatcaaaagcctctttgatacgaacacaa |
38101240 |
T |
 |
| Q |
214 |
tcaaatctttgaatgttat |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38101241 |
tcaaatctttgaatgttat |
38101259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University