View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_68 (Length: 240)
Name: NF19267_low_68
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_68 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 14 - 240
Target Start/End: Complemental strand, 28268152 - 28267926
Alignment:
| Q |
14 |
aacctgtgtacattcaataagaaatatatttttggatattgacttggagcattatagtacaaagtcatataatgaatatggaggtggaaaattacctttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268152 |
aacctgtgtacattcaataagaaatatatttttggatattgacttggagcattatagtacaaagtcatataatgaatatggaggtggaaaattacctttt |
28268053 |
T |
 |
| Q |
114 |
gatcccttggtcaggaaccaggagccatttagctgcaatagcaagtatattgcatgaaatgtttcccatggttgtttataggttattttaactcttgtga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268052 |
gatcccttggtcaggaaccaggagccatttagctgcaatagcaagtatattgcatgaaatgtttcccatggttgtttataggttattttaactcttgtga |
28267953 |
T |
 |
| Q |
214 |
caacatcaagtgaaaaagaaaatacct |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28267952 |
caacatcaagtgaaaaagaaaatacct |
28267926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University