View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_69 (Length: 238)
Name: NF19267_low_69
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_69 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 37750690 - 37750440
Alignment:
| Q |
1 |
atttttattgcgtggatatattctatcaattttt-caatttaaataaatgtcttttatttttgttaagaaaaagttatcatgtnnnnnnnnnctctaagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
37750690 |
atttttattgcgtggatatattctatcaattttttcaatttaaataaatgtcttttatttttgttaataaaaagttatcatgtaaaaaaaaactctaagg |
37750591 |
T |
 |
| Q |
100 |
ttttatctagtgataaaaaatctgatcttgaattgatagattctaaagtcttccctaccttaaaatg------------ttcaccttaaatttttcacat |
187 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37750590 |
ttttatctggtgataaaaaatctgatcttgaattgatagattctaaagtcttccctaccttaaaatggaaaatcataccttcaccttaaatttttcacat |
37750491 |
T |
 |
| Q |
188 |
aaaaaataaattatcaaattaatannnnnnnnaagaaatcaaagtaatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37750490 |
aaaaaataaattatcaaattaatattttttttaagaaatcaaagtaatatt |
37750440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University