View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_73 (Length: 232)
Name: NF19267_low_73
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 72 - 218
Target Start/End: Original strand, 42555287 - 42555433
Alignment:
| Q |
72 |
ttgcaaggtcccttacttttgatttatgagttaacaagtcacatttgatgctggtgcaaatggcaagctttacatttttgttgtatacggctgcagtaat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42555287 |
ttgcaaggtcccttacttttgatttatgagttaacaagtcacatttgatgttggtgcaaatggcaagctttacatttttgttgtatacggctgcagtaat |
42555386 |
T |
 |
| Q |
172 |
gcaacaaatagtagtaatttactttatataatttcaatttggttttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42555387 |
gcaacaaatagtagtaatttactttatataatttcaatttggttttt |
42555433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University