View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_75 (Length: 227)
Name: NF19267_low_75
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_75 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 8498358 - 8498576
Alignment:
| Q |
9 |
ttcaccgagcatcacttctatatctgatggctggcacaaggatccgggaagtcctgttgagtcacttgcatcctcagtttctgaccattttggtaacagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8498358 |
ttcaccgagcatcacttctatatctgatggctggcacaaggatccgggaagtcctgttgagtcacttgcatcctcagtttctgaccattttggtaacagt |
8498457 |
T |
 |
| Q |
109 |
agagttagaagctcagttaaatttgagaatcacgaaagtgaaactttctcagaactgatggacgatttccttgaagtcgagaaaatggcatgctcatcag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8498458 |
agagttagaagctcagttaaatttgagaatcacgaaagtgaaactttctcagaactgatggacgatttccttgaagtcgagaaaatggcatgctcatcag |
8498557 |
T |
 |
| Q |
209 |
acaatgccagtgtgcaaat |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8498558 |
acaatgccagtgtgcaaat |
8498576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University