View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19267_low_78 (Length: 219)
Name: NF19267_low_78
Description: NF19267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19267_low_78 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 203
Target Start/End: Original strand, 7948958 - 7949141
Alignment:
| Q |
20 |
ctctaataccattgttgattcttnnnnnnnncccaagaaatatcacatttaatcaagagcaatcacgaaagaaaattgaacatcacttcttgacacaaaa |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
7948958 |
ctctaataccattgttgattcttaaaaaaaacccaagaaatatcacatttaattaagagcaatcacgcaagaaagttgaacatcacttcttgacacaaaa |
7949057 |
T |
|
| Q |
120 |
ctttaactttaatttattaagtatacaatttgtcttgatgatacattatttaacgagagacttctagctcatacttaaaatacc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7949058 |
ctttaactttaatttattaagtatacaatttgtcttgatgatacattatttaacgagagacttctagctcatacttgaaatacc |
7949141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University