View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19268_high_17 (Length: 257)
Name: NF19268_high_17
Description: NF19268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19268_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 43849410 - 43849521
Alignment:
| Q |
7 |
gacacgatttaaattccaactgagatatttataaaataactattggtgtcaccgttaaataaaataagtaatttaaaaacatataagaaaagctgtccaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43849410 |
gacacgatttaaattccaactgagatatttataaaataactattggtgtcaccgttaaataaaataaataatttaaaaacatataagaaaagctgtccaa |
43849509 |
T |
|
| Q |
107 |
aagggaaaacag |
118 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43849510 |
aagggaaaacag |
43849521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 43850472 - 43850551
Alignment:
| Q |
6 |
agacacgatttaaattccaactgagatatttataaaataactattggtgtcaccgttaaataaaataagtaatttaaaaa |
85 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
43850472 |
agacacaatttaaatttcaactgagatatttataaaataactattagtgtcaccgttaaataaaataaataattttaaaa |
43850551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 199 - 244
Target Start/End: Original strand, 43849607 - 43849652
Alignment:
| Q |
199 |
acaaatgaaaaagtgtgtttgtgtgtctcaattgattcacacctct |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43849607 |
acaaatgaaaaagtgtgtttgtgtgtttcaattgattcacacctct |
43849652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University