View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19268_high_19 (Length: 240)
Name: NF19268_high_19
Description: NF19268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19268_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 3294448 - 3294673
Alignment:
| Q |
1 |
tttctttagcatagtacacttttgcaaatgttcctttacctagtactcttcccatctcgtacttgccaaataacatgtgtgctttcacttcttccattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294448 |
tttctttagcatagtacacttttgcaaatgttcctttacctagtactcttcccatctcgtacttgccaaataacatgtgtgctttcacttcttccattgg |
3294547 |
T |
|
| Q |
101 |
--nnnnnnnnnnnnnnnnnctcaatattatcactaattaagctagtaagtacttcataattag--nnnnnnnngggatttgatttgtgggtttttcttta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3294548 |
aaaaaaataaaaataaaaactcaatattatcactaattaagctagtaattacttcataattagttttttttttgggatttgatttgtgggtttttcttta |
3294647 |
T |
|
| Q |
197 |
aggttgttgatgatttaggctataag |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3294648 |
aggttgttgatgatttaggctataag |
3294673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University