View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19268_low_20 (Length: 236)
Name: NF19268_low_20
Description: NF19268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19268_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 30603400 - 30603180
Alignment:
| Q |
1 |
tcaagggttgagaaaccccgatacactttctttgttggagcattctagcaggaaggtaaattgcccacgtgttcctatcccatcctatcttatcagggaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30603400 |
tcaagggttgagaaacgccgatacactttctttgttggagcattctagcaggaaggtaaattgcccacgtgttcctatcccatcctatcttatcagggaa |
30603301 |
T |
 |
| Q |
101 |
aacaatattttattg-agctatcttcttgatgcacacactcaactatacattaacatggttaataaaatacaataagagagcatttggataaacaactta |
199 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30603300 |
aacaatattttattgaacctatcttcttgatgcacacactcaactatacattaacatggttaataaaatacaataagagagcatttggataaacaactta |
30603201 |
T |
 |
| Q |
200 |
atcaagtgtttgccacataag |
220 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
30603200 |
attaagtgtttgccacataag |
30603180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University