View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19268_low_21 (Length: 226)
Name: NF19268_low_21
Description: NF19268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19268_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 1925829 - 1925682
Alignment:
| Q |
1 |
cctcacttgggtcaaaatttcatcattgcttccatatatcacacttccatcccttttaaatataaatgtaaatattgtattaattgaaaggatgttatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1925829 |
cctcacttgggtcaaaatttcatcattgcttccatatatcacacttccatcccttttaaatataaatgtaaatattgtattaattgaaaggatattatta |
1925730 |
T |
 |
| Q |
101 |
ttcaaatgattgatatatgtttatggagggtagatggaatgttcaatg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1925729 |
ttcaaatgattgatatatgtttatggagggtagatggaatgttcaatg |
1925682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 1954619 - 1954567
Alignment:
| Q |
2 |
ctcacttgggtcaaaatttcatcattgcttccatatatcacacttccatccct |
54 |
Q |
| |
|
||||||| | |||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
1954619 |
ctcactttgttcaaaacttcttgattgcttccatatatcacacttccatccct |
1954567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 54
Target Start/End: Complemental strand, 1940135 - 1940106
Alignment:
| Q |
25 |
attgcttccatatatcacacttccatccct |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1940135 |
attgcttccatatatcacacttccatccct |
1940106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University