View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19269_high_10 (Length: 269)
Name: NF19269_high_10
Description: NF19269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19269_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 13500579 - 13500838
Alignment:
| Q |
1 |
aataggtgaagatcttgttacatatgtgatccatcctccaacaccaagctgaactagacccattaacgctaccaccctgcttaatccatagatgttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
13500579 |
aataggtgaagatcttgttacatatgtgatccatcctccaacaccaagctgaactagacccattaacgctacaaccctgcttaatccatatatgttcttc |
13500678 |
T |
|
| Q |
101 |
atcattctttcaagaacctcacgtgtttcattggcaagtggtgataaatctctttccactgttggtccttcaatttcttggtgcttgaaatttgggtttt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13500679 |
atcattctttctagaacctcacgtgtttcatttgctagtggtgataaatctctttccactgttggtccttcaatttcttggtgcttgaaatttggatttt |
13500778 |
T |
|
| Q |
201 |
cacctgggtatgggcttgagtctttctctttctctttctcagaatcagatgatgatgatg |
260 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13500779 |
cacttgggtatgggcttgagtctttctctttctctttctcagaatcagatgatgatgatg |
13500838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University