View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19269_high_7 (Length: 397)
Name: NF19269_high_7
Description: NF19269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19269_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Original strand, 52140144 - 52140526
Alignment:
| Q |
1 |
aaataaacctggccaggaccatgatatgtaacttctccgccacgttcagtacgatgaatatgaaagggtggattttgaatgtcgaaattgaggttgtcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52140144 |
aaataaacctggccaggaccatgatatgtaacttctccgccacgttcagtacgatgaatatgaaagggtggattttgaatgtcgaaattgaggttgtcgt |
52140243 |
T |
 |
| Q |
101 |
tggaactagcagtacccaatgtaaaaacagaagggtgttgcaaaacaataagagtgtcgttgcaatctccttcattttgaatctgtgatttcttttgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52140244 |
tggaactagcagtacccaatgtaaaaacagaagggtgttgcaaaacaataagagtgtcgttgcaatctccttcattttgaatctgtgatttcttttgttt |
52140343 |
T |
 |
| Q |
201 |
gacaatgtctttttgtaaagaccatgccacttcgtaagggataaattgttgatggaaatctatgagctcacagcttcgtaaacattgcaccgttttggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52140344 |
gacaatgtctttttgtaaagaccatgccacttcgtaagggataaattgttgatggaaatctatgagctcacagcttcgtaaacattgcaccgttttggtt |
52140443 |
T |
 |
| Q |
301 |
cttcttctatggatattgattatgagagaggatgattttgaatgtgaattggagtggtggcggagtgatcgaggttgaggttg |
383 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52140444 |
cttcttctatggatattgaatatgagagaggatgattttgaatgtgaattggagtggtggcggagtgatcgaggtcgaggttg |
52140526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University