View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19269_low_13 (Length: 251)
Name: NF19269_low_13
Description: NF19269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19269_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 3647994 - 3647775
Alignment:
| Q |
11 |
cagagacaaggatgagtacatcagtgattttgtgaagcatcagattcaaagctataggcatggccannnnnnnacagtagttcaacatcttcatagtaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3647994 |
cagagacaaggatgagtacatcagtgattttgtgaagcatcagattcaaagctataggcatggccatttttttacagtagttcaacatcttcatagtaca |
3647895 |
T |
|
| Q |
111 |
tacataactatcaaccctagtgaatcttaactccataagtaaagcaagttatgtaatataataagcaatgaacccccaattctcttgctcattcgtatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3647894 |
tacataactatcaaccctagtgaatctttactccataagtaaagcaagttatgtaatataataagcaatgaacccccaattctcttgctcattcgtatgt |
3647795 |
T |
|
| Q |
211 |
atgtatttacgtgtgtacgt |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3647794 |
atgtatttacgtgtgtacgt |
3647775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University