View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19269_low_14 (Length: 242)
Name: NF19269_low_14
Description: NF19269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19269_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 47624912 - 47625113
Alignment:
| Q |
17 |
cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624912 |
cagagagcacatgtataaaccattgcatgaaactttatagtacagttatgaaatgtcatggtcatgacatagtttgttttgttttccacattgcaatacc |
47625011 |
T |
|
| Q |
117 |
ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaacttgaataatttgcacagacatataaacactaaacaacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47625012 |
ccaaaaaacgatatttagatcattgtctaccacagcaaaacttgcaggcagcagagttaacttgaataatttgcacagacatataaacactaaacaacaa |
47625111 |
T |
|
| Q |
217 |
ta |
218 |
Q |
| |
|
|| |
|
|
| T |
47625112 |
ta |
47625113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University