View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19269_low_15 (Length: 239)
Name: NF19269_low_15
Description: NF19269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19269_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 3 - 216
Target Start/End: Complemental strand, 41803667 - 41803454
Alignment:
| Q |
3 |
attacatgcataatttcccataaaatttactatctaaaatctttaagaagtgttttaagatattcattacaatttctcgtaatgatataacataagcggt |
102 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
41803667 |
attacatgcacaaattcctataaaatttactatctaaaatctttaagaagtattttaagacattcattaacatttctcgtaaagatataacataagcggt |
41803568 |
T |
|
| Q |
103 |
taattgatgaaaatttatgatgagactttcaagtcatcaattatgcatttgtcatcacttgtcatatgtgtcatacgaataaaggtttgcatgtcttcaa |
202 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41803567 |
taattgataaaaatttatgatgagactttcaagtcatcaattatgcatttgtcatcacttgtcatatgtgtcatacgaataaaggtttgcatgtcttcaa |
41803468 |
T |
|
| Q |
203 |
gacaccacaccaca |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41803467 |
gacaccacaccaca |
41803454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 3383326 - 3383284
Alignment:
| Q |
171 |
tgtcatacgaataaaggtttgcatgtcttcaagacaccacacc |
213 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3383326 |
tgtcatatgaataaatgtttgcatgtcttcaagacaccacacc |
3383284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University