View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_high_16 (Length: 330)
Name: NF1926_high_16
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 21 - 316
Target Start/End: Original strand, 42836181 - 42836477
Alignment:
| Q |
21 |
aatatccttacctggtacatttaaaggctcatatccctgaacctttgtaaaatgggaggacgctaagtttgatggcagtgcacgatctctacaattatta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42836181 |
aatatccttacctggtacatttaaaggctcatatccctgaacctttgtaaaatgggaggacgctaagtttgatggcagtgcacgatctctacaattatta |
42836280 |
T |
|
| Q |
121 |
tgcaaacagaaatttattcggataatatgattaatttcttgttgcattacgagacacaaccacctatagaattaaacgtgacatggtattcgacatgtgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42836281 |
tgcaaacagaaatttattcggataatatgattaatttcttgttgcattacgagacacaaccacctatagaattaaacgtgacatggtattcgacatgtgt |
42836380 |
T |
|
| Q |
221 |
tggtgtctaacacccgtatgacacttgtttgacacatgtcgaaaaattcatgtaagtgttc-aaaaaattattagttttaacgtttcttagatgatg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42836381 |
tggtgtctaacacccgtatgacacttgtttgacacatgtcgaaaaattcatgtaagtgttcaaaaaaattattagttttaacgtttcttagatgatg |
42836477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 47 - 95
Target Start/End: Original strand, 42820232 - 42820280
Alignment:
| Q |
47 |
gctcatatccctgaacctttgtaaaatgggaggacgctaagtttgatgg |
95 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | ||||||||||| |
|
|
| T |
42820232 |
gctcatatccctggacctttgtaaaatgggaggacaccaagtttgatgg |
42820280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 95
Target Start/End: Original strand, 42503492 - 42503550
Alignment:
| Q |
37 |
acatttaaaggctcatatccctgaacctttgtaaaatgggaggacgctaagtttgatgg |
95 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||| || |||| |||||||| |
|
|
| T |
42503492 |
acatttaaaggctcatatccctggacctttgtaaagtgggatgaagctatatttgatgg |
42503550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University