View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_high_17 (Length: 319)
Name: NF1926_high_17
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 37796957 - 37796739
Alignment:
| Q |
16 |
cacttttagcataggttaatcgacatatagatgaagtttatgttattgtatggacttctatataaaagaaaaaattggggggtttgttgcagtagtttac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37796957 |
cacttttagcataggttaatcgacatatagatgaagtttatgttattgtatggacttctatatgg-----------ggggggtttgttgcagtagtttac |
37796869 |
T |
 |
| Q |
116 |
tctcttttattgatgaaaaatttattgattaaaactaacggttttgttgtagatgaagtttactctttttattgattaaaacttatataggtttcataaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37796868 |
tctcttttattgatgaaaaatttattgattaaaactaacggttttgttgtagatgaagtttactctttttattgattaaaacttatataggtttcataaa |
37796769 |
T |
 |
| Q |
216 |
a-tttatgagatccacgtgatttacgagtc |
244 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
37796768 |
attttatgagatccacgtgatttacgagtc |
37796739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University