View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1926_high_29 (Length: 229)

Name: NF1926_high_29
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1926_high_29
NF1926_high_29
[»] chr1 (1 HSPs)
chr1 (89-172)||(35953751-35953834)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 89 - 172
Target Start/End: Complemental strand, 35953834 - 35953751
Alignment:
89 catatgactgatcaaacggttgaaatgcattaattgttagacttgagattacgtacgtagaagagtgtcgtgtgacttcgttta 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35953834 catatgactgatcaaacggttgaaatgcattaattgttagacttgagattacgtacgtagaagagtgtcgtgtgacttcgttta 35953751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University