View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1926_high_31 (Length: 214)

Name: NF1926_high_31
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1926_high_31
NF1926_high_31
[»] chr2 (1 HSPs)
chr2 (1-113)||(31844406-31844521)


Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 31844521 - 31844406
Alignment:
1 ggcttagacaatcatcaccaccaacaactcatgaaccagctcaaattca---aggttcttctatgcttaatcttaaccttaataaccctactatcactac 97  Q
    |||||||||||||||||||||||||||||||||||||||||||| || |   ||||||||||||||||||||||||||||||||||||||||||||||||    
31844521 ggcttagacaatcatcaccaccaacaactcatgaaccagctcaacttaatgaaggttcttctatgcttaatcttaaccttaataaccctactatcactac 31844422  T
98 tactaaccctaattta 113  Q
    ||||||||||||||||    
31844421 tactaaccctaattta 31844406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University