View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_high_31 (Length: 214)
Name: NF1926_high_31
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 31844521 - 31844406
Alignment:
| Q |
1 |
ggcttagacaatcatcaccaccaacaactcatgaaccagctcaaattca---aggttcttctatgcttaatcttaaccttaataaccctactatcactac |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31844521 |
ggcttagacaatcatcaccaccaacaactcatgaaccagctcaacttaatgaaggttcttctatgcttaatcttaaccttaataaccctactatcactac |
31844422 |
T |
|
| Q |
98 |
tactaaccctaattta |
113 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31844421 |
tactaaccctaattta |
31844406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University