View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_high_32 (Length: 210)
Name: NF1926_high_32
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 193
Target Start/End: Complemental strand, 40023601 - 40023425
Alignment:
| Q |
17 |
gaaaaggatcatgagagagaaagacagagatggccaccctagggcaactgcatcggcattctccttcagtaacatgtaggttttacgggcggggaagggt |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023601 |
gaaaaggatcatgagagagaaagaaagagatggccaccctagggcaactgcatcggcattctccttcagtaacatgtaggttttacgggcggggaagggt |
40023502 |
T |
|
| Q |
117 |
tctagttagggtgacataaataggggtgattggtctgaggtgagcaggcaacgacgaaaagcgatcagtccaggaag |
193 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
40023501 |
tctagttagagtgacataaatatgggtgattggtctgaggtgagcaggcaacgacaaaaagcgatcagtccaagaag |
40023425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University