View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1926_low_18 (Length: 319)

Name: NF1926_low_18
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1926_low_18
NF1926_low_18
[»] chr4 (1 HSPs)
chr4 (16-244)||(37796739-37796957)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 37796957 - 37796739
Alignment:
16 cacttttagcataggttaatcgacatatagatgaagtttatgttattgtatggacttctatataaaagaaaaaattggggggtttgttgcagtagtttac 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||||    
37796957 cacttttagcataggttaatcgacatatagatgaagtttatgttattgtatggacttctatatgg-----------ggggggtttgttgcagtagtttac 37796869  T
116 tctcttttattgatgaaaaatttattgattaaaactaacggttttgttgtagatgaagtttactctttttattgattaaaacttatataggtttcataaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37796868 tctcttttattgatgaaaaatttattgattaaaactaacggttttgttgtagatgaagtttactctttttattgattaaaacttatataggtttcataaa 37796769  T
216 a-tttatgagatccacgtgatttacgagtc 244  Q
    | ||||||||||||||||||||||||||||    
37796768 attttatgagatccacgtgatttacgagtc 37796739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University