View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_low_19 (Length: 315)
Name: NF1926_low_19
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 6 - 300
Target Start/End: Original strand, 29136129 - 29136418
Alignment:
| Q |
6 |
ttgtgatggtaataaattatttgaagggatagaaagagttcaactttaggttgttggggtggaataaacaagtcagtcaaattaaattagtgttgttttg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136129 |
ttgtgatggtaataaattatttgaagggatagaaagagttcaactttaggttgttggggtggaataaacaagtcagtcaaattaaattagtgttgttttg |
29136228 |
T |
 |
| Q |
106 |
agtcaannnnnnnnnnnnnnnnnnnngtctaagtaaagcacaagttagcaacatcgtgtggtcgatccaagtggtaagagactcgggcaccttaagtagg |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29136229 |
agtcaattttttttcttttttttt--gtctaagtaaagcacaagttagcaacatcgtgtg-tcgatccaagtggtaagagactcgagcaccttaagtagg |
29136325 |
T |
 |
| Q |
206 |
tggtcagtagtacaatctctgactgtgtatggaaaaatctcaattgggagggagaacttaccttgtgtgtccaacaagtttcccagaggagatta |
300 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29136326 |
tggtcagtagttcaatctctgactgt--atggaaaaatctcaattgggagggagaacttaccttgtgtgtccaacaagtttcccagaggagatta |
29136418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University