View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_low_20 (Length: 299)
Name: NF1926_low_20
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 283
Target Start/End: Original strand, 16423410 - 16423677
Alignment:
| Q |
16 |
atgttattcaatacggttaacgaagaactagaccttcattgattaagcattaatatgtatgataatgtactatcattgttataatacaaaaaatgatatt |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
16423410 |
atgttattcaatacggttaatgaagaactagaccttcattgattaagcattaatatgcatgataatataccgtcattgttataatacaaaaaatgatatt |
16423509 |
T |
 |
| Q |
116 |
ctaaaccaatcttgtgtgatacatatatatgggttgttgcccttaattttagtatctattggtattgaattgattagagcaaaagatttaggccattcat |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
16423510 |
ctaaaccaatcttgtgggatacatatatatgggttgttgcccttaattttagtatctactgttattgaattgattagagcagaagatttagggcattcat |
16423609 |
T |
 |
| Q |
216 |
gcggtaaactgcatcgccaataagtgtgtatatggttagttcaaaaatttaattatatggttagttta |
283 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16423610 |
gtggtaaactgcatcaccaataagtgtgtatatggttagttcaaaaatttaattatatggttagttta |
16423677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University