View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1926_low_24 (Length: 265)
Name: NF1926_low_24
Description: NF1926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1926_low_24 |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0555 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 7e-92; HSPs: 85)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 17455023 - 17454772
Alignment:
| Q |
1 |
atcaaaaccggagagttcacaaaatatacaaattttgattgtttttaaatccgaaataccgagtttgaaatctaggatcgtctgaacttgatctcacagt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| | ||| |
|
|
| T |
17455023 |
atcaaaaccggaaagttcacaaaatatacaaattttgattgtttttaaatccaaaataccgagtttggaatctagaatcgtctgaacttgatctaatagt |
17454924 |
T |
 |
| Q |
101 |
cattgatacgttgattgggtgaacgtatagtctct----tacgaggaatcagtatttataatttatttcaatctcactttcacattaaaacataacacca |
196 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| ||| || | ||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17454923 |
cattgatatgttgattgggtgaacgtaaagtctctagactacaagtagtcaatatttataatttatttcaatctcactttcacattaaaccataacacca |
17454824 |
T |
 |
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
17454823 |
gttgtatccccgtgagcttatctcagttggtagagatattgcatattatatg |
17454772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 17433923 - 17433742
Alignment:
| Q |
1 |
atcaaaaccggagagttcacaaaatatacaaattttgattgtttttaaatccgaaataccgagtttgaaatctaggatcgtctgaacttgatctcacagt |
100 |
Q |
| |
|
||||||| || ||| |||| |||||| ||| ||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||| || || |
|
|
| T |
17433923 |
atcaaaatcgaagaattcataaaatacacatattttgattgtttttaaatccaaaataccgagtttggaatctaggattgtctgaacttgatctaacggt |
17433824 |
T |
 |
| Q |
101 |
cattgatacgttgattgggtgaacgtatagtctct----tacgaggaatcagtatttataatttatttcaatctcactttca |
178 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17433823 |
cattgatatgttgattgggtgaacatatagtctctatactacaaggaatcaacatttataatttgtttcaatctcactttca |
17433742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 9435621 - 9435669
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9435621 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
9435669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 7545325 - 7545372
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7545325 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
7545372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 7865429 - 7865382
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7865429 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
7865382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 9246456 - 9246409
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9246456 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
9246409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 10934595 - 10934642
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10934595 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
10934642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 15091444 - 15091491
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15091444 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
15091491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 33573813 - 33573860
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33573813 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
33573860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 607184 - 607230
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
607230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 3794246 - 3794200
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
3794200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 4408355 - 4408401
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4408401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7207841 - 7207887
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7207887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 9372274 - 9372228
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9372228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 17441912 - 17441866
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17441866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 19953901 - 19953855
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19953855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 30885644 - 30885598
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30885644 |
tatccccgtgagcttagctcagttggtagggatattgcatattatat |
30885598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 1968992 - 1969039
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
1968992 |
tatccccgtgagcttagctcagttggtagggatattacatattatatg |
1969039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 6210050 - 6210097
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6210050 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatg |
6210097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 8439675 - 8439718
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
8439718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 9704413 - 9704460
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9704413 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatg |
9704460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 19892349 - 19892302
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgt |
19892302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 28030860 - 28030907
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28030860 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
28030907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 31802049 - 31802096
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31802049 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatg |
31802096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 3294765 - 3294807
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
3294807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 4661093 - 4661139
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
4661139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8857087 - 8857133
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
8857133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 13732809 - 13732855
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
13732855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 27094880 - 27094834
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
27094834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 29284263 - 29284309
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 22574864 - 22574913
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
22574864 |
tgtatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
22574913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 2251837 - 2251881
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcatactatatg |
2251881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 4869768 - 4869725
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattatatg |
4869725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 7177291 - 7177338
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
7177291 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatg |
7177338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 10483610 - 10483563
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
10483610 |
tatccccgtgatcttagctcagttggtagggatattgcattttatatg |
10483563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 10517195 - 10517242
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| ||||||| |
|
|
| T |
10517195 |
tatccccgtgagcttagctcagttggtatggatattgcattttatatg |
10517242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 19374914 - 19374867
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
19374914 |
tatccccgtgagcttagctcagttagtaggaatattgcatattatatg |
19374867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 22997337 - 22997380
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatgt |
22997380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 206 - 249
Target Start/End: Complemental strand, 23791064 - 23791021
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatgt |
23791021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 28237326 - 28237279
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
28237326 |
tatcctcgtgagcttaactcagttggtagggatattgcatattatatg |
28237279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 30704957 - 30705004
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
30704957 |
atccccgtgagcttagttcagttggtagggatattgcatgttatatgt |
30705004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 32166369 - 32166412
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
32166369 |
cccgtgagcttagctcaattggtagggatattgcatattatatg |
32166412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 32611620 - 32611581
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatg |
32611581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 34432867 - 34432824
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
34432824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 978207 - 978161
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
978207 |
atccccgtgagtttagctcagttagtagggatattgcatattatatg |
978161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 3196619 - 3196661
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggatattacatattatat |
3196661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 3640511 - 3640557
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
3640511 |
atcctcgtgagcttagctcagttggtagggatattgcatagtatatg |
3640557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21248529 - 21248575
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttatatg |
21248575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 28148806 - 28148760
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28148806 |
atccccttgaacttagctcagttggtagggatattgcatattatatg |
28148760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 32813723 - 32813677
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatattatatg |
32813677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 244
Target Start/End: Original strand, 743565 - 743602
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatatta |
743602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 7414331 - 7414372
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatg |
7414372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 361166 - 361206
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatg |
361206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 2500588 - 2500540
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
2500588 |
tatctccgtgtgcttagcttagttggtagggatattgcatattatatgt |
2500540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 27218884 - 27218928
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27218884 |
cccgtgaccttagctcagttgatagggatattgcatattatatgt |
27218928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 31935102 - 31935142
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatg |
31935142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 216202 - 216249
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
216202 |
tatcccagtgagcttagctcaattggtagggatattgcatgttatatg |
216249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 6419156 - 6419109
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||| |||||||||||| | |||||||||||||||| |
|
|
| T |
6419156 |
tatccccgtgagtttaactcagttggtagagatattgcatattatatg |
6419109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 246
Target Start/End: Complemental strand, 7470805 - 7470758
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
7470805 |
tgtatcctcgtaagcttagctcagttggtagggataatgcatattata |
7470758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 15964009 - 15963970
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatg |
15963970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 247
Target Start/End: Complemental strand, 19618799 - 19618756
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
19618799 |
ccccgtgagtttagctcaattggtagggatattgcatattatat |
19618756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 21203038 - 21203081
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
21203038 |
cccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 28222863 - 28222906
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
28222863 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
28222906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 31104878 - 31104925
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| |||| ||||||||||| |
|
|
| T |
31104878 |
tatccccgtgagcttagttcagttgatagggatattacatattatatg |
31104925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 31705896 - 31705943
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| ||||||| |
|
|
| T |
31705896 |
atccccgtgagcttagctcagttggtatggatattgcattatatatgt |
31705943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 32050035 - 32049992
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
32050035 |
cccgtgagcttaactcagctggtagggatattgcatattatatg |
32049992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 492903 - 492945
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
492903 |
ccgtgagcttagctcagttggcaaggatattgcatattatatg |
492945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 2816887 - 2816933
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
2816887 |
atccccatgagcttagctcaattggtagggatattgcatgttatatg |
2816933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Complemental strand, 3795835 - 3795801
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
3795835 |
ttagctcagttggtagggatattgcatattatatg |
3795801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 5052146 - 5052100
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| |||| ||||||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatg |
5052100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7581041 - 7581087
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||| ||||||| |
|
|
| T |
7581041 |
atccccgtgagcttagcttagctggtagggatattgcattttatatg |
7581087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8297624 - 8297670
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | |||||| ||||||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttatatg |
8297670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 10628615 - 10628657
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||| |||||||||| |||||||||||||||| |
|
|
| T |
10628615 |
ccgtgagtttagctcggttggtagggatattgcatattatatg |
10628657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 12284122 - 12284164
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatg |
12284164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Complemental strand, 16966455 - 16966421
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
16966455 |
ttagctcagttggtagggatattgcatattatatg |
16966421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 29733625 - 29733671
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||| ||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatg |
29733671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 249
Target Start/End: Original strand, 32837344 - 32837386
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
32837344 |
cgtgagcttagctcagttgctagggatattacatattatatgt |
32837386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 33697186 - 33697140
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||||||| ||||||| |
|
|
| T |
33697186 |
atccccgtgagcttaactcagttgatagggatattgcattttatatg |
33697140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 2688648 - 2688607
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
2688648 |
ccgttagcttagctcagttggtaaggatattgcatattatat |
2688607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 7328716 - 7328675
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatat |
7328675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 7418280 - 7418321
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatg |
7418321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Complemental strand, 10501199 - 10501166
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
10501199 |
tagctcagttggtagggatattgcatattatatg |
10501166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 20568357 - 20568312
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| |||||| |
|
|
| T |
20568357 |
tccccgtgagcttagctcagttggtaaggacattgcataatatatg |
20568312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 204 - 249
Target Start/End: Original strand, 26347403 - 26347448
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
26347403 |
ccccgtgaacttagctcagttggtagagatattgtatattatatgt |
26347448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 238
Target Start/End: Complemental strand, 30391293 - 30391257
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgc |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
30391293 |
atccccgtgagcttagctcagttgttagggatattgc |
30391257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 139)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 198 - 248
Target Start/End: Original strand, 1937303 - 1937353
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1937303 |
ttgtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
1937353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 43656032 - 43656080
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43656032 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
43656080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 12299 - 12252
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12299 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
12252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 94585 - 94538
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
94585 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
94538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 8265264 - 8265311
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8265264 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
8265311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 17027954 - 17027907
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17027954 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
17027907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 17558390 - 17558343
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17558390 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
17558343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 17698518 - 17698565
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17698518 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
17698565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 30972891 - 30972844
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30972891 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
30972844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 39362261 - 39362308
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39362261 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
39362308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 41689878 - 41689925
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41689878 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
41689925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 10736947 - 10736901
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10736901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 11875883 - 11875929
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
11875929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 11890890 - 11890936
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
11890936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 16449122 - 16449168
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
16449168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 26022244 - 26022290
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
26022290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 29716857 - 29716903
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
29716903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 32719680 - 32719634
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
32719634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 34413059 - 34413105
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
34413105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 35939484 - 35939530
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
35939530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 23178963 - 23178918
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatg |
23178918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 34266006 - 34266055
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34266006 |
tgtatccccgcgagcttagctcagttggtagggatattgcatattatatg |
34266055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 6659284 - 6659332
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
6659284 |
gtatccccgtgagattagctcagttggtagggatattgcatattatatg |
6659332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 6739686 - 6739734
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
6739686 |
gtatccccgtgagattagctcagttggtagggatattgcatattatatg |
6739734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 199 - 243
Target Start/End: Complemental strand, 38745355 - 38745311
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38745355 |
tgtatccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 44340418 - 44340374
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8034486 - 8034439
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
8034486 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatg |
8034439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 26567322 - 26567275
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
26567322 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatg |
26567275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 29514622 - 29514669
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
29514622 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatg |
29514669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 34158727 - 34158684
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
34158684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 42880945 - 42880992
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgt |
42880992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 133412 - 133458
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
133458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 2787150 - 2787108
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
2787108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 2792776 - 2792822
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatg |
2792822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 6280477 - 6280523
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatattatatg |
6280523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 8698648 - 8698606
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
8698606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 14876675 - 14876629
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatg |
14876629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 20540179 - 20540133
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatg |
20540133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 23858198 - 23858240
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23858198 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
23858240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 244
Target Start/End: Original strand, 28909462 - 28909504
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
28909504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 33617969 - 33618015
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
33618015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 34894366 - 34894412
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
34894412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 37717360 - 37717406
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
37717406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 38219641 - 38219595
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatg |
38219595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 43284039 - 43283993
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
43283993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 2079746 - 2079698
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||| |||||||| |
|
|
| T |
2079746 |
tatccccgtgagcttagctcagttggtagtggtattacattttatatgt |
2079698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 7388450 - 7388498
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
7388450 |
gtatccccgtgaacttaactcagttggtagggatattgcatattatatg |
7388498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 27077164 - 27077124
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcatattatatg |
27077124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 42006781 - 42006821
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatg |
42006821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 257535 - 257582
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
257535 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
257582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 658385 - 658338
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
658385 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
658338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 844121 - 844074
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
844121 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
844074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 2590146 - 2590193
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattatatgt |
2590193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 10200755 - 10200708
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
10200755 |
tatcctcgtgagcttagctcagttggtagagatattgcatattatatg |
10200708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 244
Target Start/End: Original strand, 10568081 - 10568124
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
10568081 |
tatccccgtgagtttagctcagttggtagggatattgcatatta |
10568124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 10587347 - 10587304
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattatatg |
10587304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 13406596 - 13406643
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
13406596 |
tatctccgtgagcttaactcagttggtagggatattgcatattatatg |
13406643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 16432202 - 16432155
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16432202 |
tatctccgtgaacttagctcagttggtagggatattgcatattatatg |
16432155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 24458313 - 24458360
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
24458313 |
tatccccgtgagcttagctcagttggaagggatattgtatattatatg |
24458360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 28420498 - 28420451
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28420498 |
tatcctcgtgagcttagctcagttggtaggaatattgcatattatatg |
28420451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 29729113 - 29729160
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29729113 |
gtatccccgtgagtttagttcagttggtagggatattgcatattatat |
29729160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 34472297 - 34472340
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
34472340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 40362048 - 40362091
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattatatg |
40362091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 2168521 - 2168475
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
2168521 |
tatccccgtgagcttagctcagttggtagggatattacattttatat |
2168475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 3190022 - 3189976
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatg |
3189976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 5326243 - 5326197
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatg |
5326197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 5328640 - 5328594
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatg |
5328594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7797127 - 7797173
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatg |
7797173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7816400 - 7816446
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatg |
7816446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 9187296 - 9187250
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggatattacattttatatg |
9187250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 10083164 - 10083206
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
10083206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 17072636 - 17072590
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatg |
17072590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 17575635 - 17575681
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatg |
17575681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 23435306 - 23435260
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatg |
23435260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 24296937 - 24296895
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatg |
24296895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 26280857 - 26280811
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatg |
26280811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 28628662 - 28628708
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
28628662 |
atccccgtgagcttagctcagttggtacggatattacatattatatg |
28628708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 31451026 - 31450984
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
31450984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 36540284 - 36540330
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatg |
36540330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 37092088 - 37092134
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatg |
37092134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 203 - 245
Target Start/End: Original strand, 38402249 - 38402291
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattat |
38402291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 38620414 - 38620368
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
38620414 |
atccctgtgagcttagctcagttggtagggatattgtatattatatg |
38620368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 38955267 - 38955221
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatg |
38955221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 43186850 - 43186896
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
43186850 |
atccgcgtgagtttagctcagttggtagggatattgcatattatatg |
43186896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 197131 - 197090
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
197131 |
gtgagcttagctcagttggtagggatattgcatataatatgt |
197090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 311968 - 311927
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
311968 |
gtgagcttagctcagttggtagggatattgcatataatatgt |
311927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 10573103 - 10573144
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatg |
10573144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 26192784 - 26192743
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatg |
26192743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 38344051 - 38344092
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
38344092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 39587544 - 39587589
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcattttatat |
39587589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 41458297 - 41458338
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
41458297 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
41458338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 4615747 - 4615703
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatattatatg |
4615703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 8862193 - 8862153
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatg |
8862153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 11297063 - 11297019
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
11297063 |
cccgtgagcttagttcagttggtagggatattgcattttatatgt |
11297019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 14245142 - 14245190
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
14245142 |
tatccccgtgagtttaggtaagttggtagggatattgcatattatatgt |
14245190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 33604246 - 33604210
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33604246 |
tatccccgtgagcttagctcagttggtagggatattg |
33604210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 33838324 - 33838368
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
33838324 |
cccgtgagtttagctcagttggtagggatattgcaaattatatgt |
33838368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 43856453 - 43856409
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
43856453 |
ccccgtgagcttaactcagttggtagggatattgcattttatatg |
43856409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 4654176 - 4654137
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatg |
4654137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 5570894 - 5570937
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
5570894 |
cccgtgagcttagctcagttggttgggatattgcatgttatatg |
5570937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 7194266 - 7194305
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatg |
7194305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 7453349 - 7453396
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||| ||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
7453349 |
atccccgtgagtttagctcagctggtagggatattgcattttatatgt |
7453396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 7765643 - 7765686
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
7765643 |
cccgtgagcttagctcagttggtatggatattacatattatatg |
7765686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8953943 - 8953896
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
8953943 |
tatcctcgtgagcttaacacagttggtagggatattgcatattatatg |
8953896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 22274677 - 22274638
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
22274677 |
tgagtttagctcagttggtagggatattgcatattatatg |
22274638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 29260615 - 29260662
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
29260615 |
tatccacgtgagcttaactcagctggtagggatattgcatattatatg |
29260662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 32258007 - 32258050
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| |||| |
|
|
| T |
32258007 |
cccgtgagattagctcagttggtagggatattgcatattctatg |
32258050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 43053959 - 43053912
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
43053959 |
tatctccgtgagcttaactcagttggtagggatatttcatattatatg |
43053912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 481009 - 481047
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtagggacattgcata |
481047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 7764004 - 7763966
Alignment:
| Q |
210 |
gagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatg |
7763966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 10030409 - 10030455
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||| |||||||||||||||| | |||||||||||||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatg |
10030455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Complemental strand, 12273747 - 12273705
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
12273747 |
cccgtgagcttagctcagttagtaggaatattgcatattatat |
12273705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Complemental strand, 18452355 - 18452313
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatat |
18452313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 241
Target Start/End: Complemental strand, 22437858 - 22437824
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22437858 |
cgtgagcttagctcagttggtagggatattgcata |
22437824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 22487876 - 22487918
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| ||||||| |
|
|
| T |
22487876 |
ccgtgagtttagctcagttggtagggatattgcattttatatg |
22487918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 26734069 - 26734115
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatg |
26734115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 37090686 - 37090640
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatg |
37090640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 37524272 - 37524234
Alignment:
| Q |
210 |
gagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatg |
37524234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 41616439 - 41616393
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||| |||||||||| |
|
|
| T |
41616439 |
atccccgtgagcataactcagttggtagggatattgtatattatatg |
41616393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 43980382 - 43980340
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatg |
43980340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 229
Target Start/End: Complemental strand, 21548580 - 21548551
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21548580 |
gtatccccgtgagcttagctcagttggtag |
21548551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 246
Target Start/End: Original strand, 42457133 - 42457174
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
42457133 |
cccgtgagtttatctcagttggtagggatattgcatattata |
42457174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 1632507 - 1632467
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatg |
1632467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 3227073 - 3227026
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||| |||||||||| || |||||||||||||||| |
|
|
| T |
3227073 |
gtatccccgtgagattagttcagttggta-ggatattgcatattatatg |
3227026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 248
Target Start/End: Complemental strand, 7109353 - 7109317
Alignment:
| Q |
212 |
gcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatg |
7109317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 8969098 - 8969138
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatg |
8969138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 10594287 - 10594243
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||| ||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcattttatatg |
10594243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 11127905 - 11127945
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
11127905 |
cgtgaacttagctcagttggtaggaatattgcatattatat |
11127945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 13059249 - 13059221
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtaggg |
13059221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 18942918 - 18942958
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
18942918 |
gtgagcttagctcagttggtagggataatgcataatatatg |
18942958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 23339966 - 23339922
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||| ||||||||||| |
|
|
| T |
23339966 |
cccgtgagcttaactcagttggtagagatattgtatattatatgt |
23339922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 29499578 - 29499622
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||| |||||||| |
|
|
| T |
29499578 |
cccgtgaactcagctcagttggtagggatattgcatgttatatgt |
29499622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 31712545 - 31712593
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||| |||| |||| ||||| ||||||||||| |
|
|
| T |
31712545 |
tatccccgtgagtttagctcacttggcagggatattgtatattatatgt |
31712593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 37535566 - 37535526
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
37535566 |
gtgagtttagctcaattggtagggatattgcatattatatg |
37535526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 38337097 - 38337053
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
38337097 |
cccgtgaatttagttcagttggtagggatattgcatattatatgt |
38337053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 39974841 - 39974877
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39974841 |
cccgtgagcttagctcagttggtaggaatattgcata |
39974877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 40322937 - 40322889
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
40322937 |
tatccccgtgagcttggctcagttggtagaaatattgcattttatatgt |
40322889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 111)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 198 - 248
Target Start/End: Complemental strand, 6438141 - 6438091
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6438141 |
ttgtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
6438091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 1570266 - 1570219
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1570266 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
1570219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 22563382 - 22563429
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22563382 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
22563429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 25999846 - 25999893
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25999846 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
25999893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 26584820 - 26584773
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26584820 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
26584773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 35605697 - 35605650
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35605697 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
35605650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 40519618 - 40519571
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40519618 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
40519571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 42054330 - 42054377
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
42054377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 197 - 248
Target Start/End: Complemental strand, 42490488 - 42490437
Alignment:
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42490488 |
gttggatccccgtgagcttagctcagttggtagggatattgcatattatatg |
42490437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 46965736 - 46965783
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46965736 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
46965783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 1151755 - 1151801
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1151755 |
tatccccgtgagcttagctcagttggtagggatattgcatattatat |
1151801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 3269616 - 3269662
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
3269662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 4482671 - 4482625
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4482625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 6702573 - 6702619
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
6702619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 7166300 - 7166254
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7166254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8865851 - 8865897
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
8865897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 10664867 - 10664821
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10664821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 15819674 - 15819628
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
15819628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21265653 - 21265699
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
21265699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 32594248 - 32594294
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
32594294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 33207202 - 33207248
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
33207248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 33254725 - 33254771
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
33254771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 33274897 - 33274943
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
33274943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 50899583 - 50899537
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
50899537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 16343027 - 16343071
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
16343071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 40375390 - 40375342
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
40375390 |
gtatccccgtgagcatagctcagttggtagggatattgcatattatatg |
40375342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 2556552 - 2556599
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2556552 |
tatccccgtaagcttagctcagttggtagggatattgcatattatatg |
2556599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 2754356 - 2754403
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
2754356 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatg |
2754403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 6130107 - 6130060
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
6130107 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatg |
6130060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 6893311 - 6893264
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
6893311 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatg |
6893264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 9866254 - 9866211
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
9866211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 13773164 - 13773211
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
13773164 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatg |
13773211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 18467272 - 18467225
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
18467272 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatg |
18467225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 43884790 - 43884837
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
43884790 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatg |
43884837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 44732629 - 44732676
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
44732629 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatg |
44732676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 47402737 - 47402690
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
47402737 |
tatccccgtgagcttagctcagctggtagggatattgcatattatatg |
47402690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 48638528 - 48638575
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
48638528 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatg |
48638575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 1836500 - 1836546
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
1836546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 2277755 - 2277797
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
2277797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 11215002 - 11215044
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
11215044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 16526250 - 16526204
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatg |
16526204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 18551706 - 18551660
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatattatatg |
18551660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 34058215 - 34058257
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
34058257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 37662630 - 37662584
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
37662584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 40520827 - 40520873
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
40520873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 51050187 - 51050233
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
51050233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 18216900 - 18216949
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||| |||| |
|
|
| T |
18216900 |
tgtatccccgtgagcttagctcagttggtagggatattacatattttatg |
18216949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 2352639 - 2352592
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
2352639 |
tatccccgtgagcttagctcagttgatagagatattgcatattatatg |
2352592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 7180688 - 7180641
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
7180688 |
tatccccgtgaggttagctcagttggtaggaatattgcatattatatg |
7180641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 248
Target Start/End: Complemental strand, 14760826 - 14760778
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
14760826 |
ttgtatccccgtgagcttagctcagttggta--gatattgcatattatatg |
14760778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 18534002 - 18534045
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatgt |
18534045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 19011351 - 19011398
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
19011351 |
tatctccgtgagcttagctcaattggtagggatattgcatattatatg |
19011398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 23545528 - 23545481
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
23545528 |
tatccccgtgagctaagcttagttggtagggatattgcatattatatg |
23545481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 26550490 - 26550537
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
26550490 |
tatccccgtgagcttaactcagttggtagggatattgcatactatatg |
26550537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 27818568 - 27818611
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27818568 |
ccccctgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 29188632 - 29188679
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29188632 |
tatccccgtgattttagctcagttggtagggatattgcatattatatg |
29188679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 32556999 - 32556956
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
32556999 |
cccgtgagcttagctcagctggtagggatattgcatattatatg |
32556956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 47478921 - 47478874
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
47478921 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatgt |
47478874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8415726 - 8415772
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
8415726 |
atccacgtgagcttagctcagttcgtagggatattgcatattatatg |
8415772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 12502327 - 12502281
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
12502327 |
atccccgtaagcatagctcagttggtagggatattgcatattatatg |
12502281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 52426982 - 52426940
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
52426982 |
ccgtgagcttagctcagttgatagggatattgcatattatatg |
52426940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 3694982 - 3694941
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgt |
3694941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 42299581 - 42299540
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatg |
42299540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 52369599 - 52369640
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
52369599 |
cgtgagtttagctcagttggtagggatattgcatattatatg |
52369640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 24874971 - 24875007
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcata |
24875007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 25034904 - 25034948
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
25034904 |
cccgtgagcttagctcagttggtaggaatattgcattttatatgt |
25034948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 27344475 - 27344523
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27344475 |
tatcctcgtgagcttagctcagttggtagacatattgcatattatatgt |
27344523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 242
Target Start/End: Complemental strand, 45333784 - 45333744
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatat |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcatat |
45333744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 46225390 - 46225430
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatg |
46225430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 7191028 - 7191075
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
7191028 |
tatctccgtgaccttagctcagttgatagggatattgcatattatatg |
7191075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8984579 - 8984532
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
8984579 |
tatctccgtgagcttaactcagttggcagggatattgcatattatatg |
8984532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 12404352 - 12404399
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
12404352 |
tatccccgtgagattagatcaattggtagggatattgcatattatatg |
12404399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 244
Target Start/End: Original strand, 15390220 - 15390259
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
15390220 |
cccgtgagcttaactcagttggtagggatattgcatatta |
15390259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 15775739 - 15775782
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
15775739 |
cccgtgagcttaactcaattggtagggatattgcatattatatg |
15775782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 34580860 - 34580813
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| | |||||||||||||||| ||||| |||||||||| |
|
|
| T |
34580860 |
tatccccgtgagttcagctcagttggtagggatattgtatattatatg |
34580813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 42848797 - 42848758
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
42848797 |
tgagcttagctcagttgatagggatattgcatattatatg |
42848758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 44019272 - 44019319
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
44019272 |
tatctccgtgagcttagctcagttgatagggatattgcattttatatg |
44019319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 46021953 - 46021906
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
46021953 |
tatccccgtgagcgtagctcagtaagtagggatattgcatattatatg |
46021906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 46161189 - 46161150
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatg |
46161150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 51933510 - 51933549
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatg |
51933549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 4553619 - 4553573
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatattatatg |
4553573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 5190854 - 5190808
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| ||| |||||||||||| |
|
|
| T |
5190854 |
atccccatgagcttagctcaattggtagggatatcgcatattatatg |
5190808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 6463109 - 6463063
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
6463109 |
atccccatgagcttagctcagttggtagggatattgtattttatatg |
6463063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 11065117 - 11065163
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| || ||| | |||||||||||||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatattatatg |
11065163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 13538519 - 13538473
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
13538519 |
atcccagtgaacttagttcagttggtagggatattgcatattatatg |
13538473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 249
Target Start/End: Original strand, 14349646 - 14349688
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14349646 |
cgtgaacttagctcagttggtagagatattgcatattatatgt |
14349688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 15595726 - 15595768
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
15595726 |
ccgtgagcttagctcagttggtagggacattgcataatatatg |
15595768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 16182199 - 16182241
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatg |
16182241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 240
Target Start/End: Complemental strand, 17671483 - 17671445
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
17671483 |
atccccgtgagcttagctcagttggtagggatatcgcat |
17671445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 25580689 - 25580731
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatg |
25580731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 27650694 - 27650740
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
27650694 |
atcctcgtgagctaagttcagttggtagggatattgcatattatatg |
27650740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 28867480 - 28867522
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
28867480 |
ccgtgaacttagctcagttggtaggaatattgcatattatatg |
28867522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 31762070 - 31762024
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||| ||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
31762070 |
tatcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 33033127 - 33033169
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatg |
33033169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 34271841 - 34271887
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
34271841 |
atccccgtgagtttagctcagctggtagggatattacatattatatg |
34271887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 43668030 - 43667984
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||| |||| | |||||||||||||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatg |
43667984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 45271763 - 45271809
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| | ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
45271763 |
atccccgttaacttagttcagttggtagggatattgcatattatatg |
45271809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 48897190 - 48897144
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatg |
48897144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 923180 - 923131
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||| ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
923180 |
tgtattcccgtgaatttagcgcagttggtagggatattgcatattatatg |
923131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 6712177 - 6712136
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
6712177 |
cgtgagcttagctcagttggtaggtatattgcattttatatg |
6712136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 12650456 - 12650411
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||| ||||||| |
|
|
| T |
12650456 |
tccccgtgaacttagctcagttggtaaggatattgcatgttatatg |
12650411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 231
Target Start/End: Complemental strand, 23933141 - 23933112
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23933141 |
atccccgtgagcttagctcagttggtaggg |
23933112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 248
Target Start/End: Complemental strand, 27642790 - 27642753
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
27642790 |
agcttagctcagttggtagggatattgcattttatatg |
27642753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 204 - 241
Target Start/End: Complemental strand, 36666647 - 36666610
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36666647 |
ccccgtgagcttagctcagttggtagggacattgcata |
36666610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 45517337 - 45517296
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
45517337 |
ccgtgagcttagttcagttggtagggatattgcattttatat |
45517296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Complemental strand, 47930731 - 47930698
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
47930731 |
tagctcagttggtagggatattgcatattatatg |
47930698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 17580320 - 17580360
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
17580320 |
gtgaacttagctcagttggtagggatattgcatgttatatg |
17580360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 33200036 - 33200064
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33200036 |
tccccgtgagcttagctcagttggtaggg |
33200064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 48607823 - 48607775
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||| |||||||| |||||||| |
|
|
| T |
48607823 |
tatccccgtgagtttaactcagttgatagggatattgcattttatatgt |
48607775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 49253609 - 49253652
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
49253609 |
ccccgtgagcttagctaagttggta-ggatattgcatattatatg |
49253652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 50746707 - 50746755
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
50746707 |
tatccctgtgaccttagctcagttggtagggatatcacatattatatgt |
50746755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 103)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 33229009 - 33228960
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33229009 |
tgtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
33228960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 3446726 - 3446773
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3446726 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
3446773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8250375 - 8250328
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8250375 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
8250328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 18694781 - 18694828
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18694781 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
18694828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 19281604 - 19281651
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19281604 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
19281651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 22653718 - 22653671
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22653718 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
22653671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 25857369 - 25857322
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25857369 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
25857322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 44948592 - 44948639
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44948592 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
44948639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 4183173 - 4183219
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4183219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 19684070 - 19684116
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19684116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 38400307 - 38400353
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
38400353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 30932522 - 30932473
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
30932522 |
tgtatccccgtgagcttacctcagttggtagggatattgcatattatatg |
30932473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 34613978 - 34614022
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
34614022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 1260182 - 1260229
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgt |
1260229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 2289606 - 2289653
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2289606 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatg |
2289653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 2643693 - 2643740
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
2643693 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatg |
2643740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 3438944 - 3438991
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
3438944 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatg |
3438991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 4562826 - 4562779
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
4562826 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatg |
4562779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 5521294 - 5521247
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
5521294 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatg |
5521247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 6331558 - 6331605
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
6331558 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatg |
6331605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 11050831 - 11050784
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
11050831 |
tatccccgtgagcttagctcagttggtagggatattacatattatatg |
11050784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 15485658 - 15485705
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
15485658 |
tatccccgtgagcttagctcagttggtaaggatattgcatattatatg |
15485705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 17034731 - 17034778
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
17034731 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatg |
17034778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 17078453 - 17078500
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
17078453 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatg |
17078500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 39408764 - 39408717
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
39408764 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatg |
39408717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 40535523 - 40535476
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
40535523 |
tatccccgtgagcttagctcagttggtacggatattgcatattatatg |
40535476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 1844814 - 1844860
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
1844860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 15233410 - 15233456
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatg |
15233456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 15764927 - 15764973
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15764927 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
15764973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 18278490 - 18278444
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
18278444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 27297172 - 27297218
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatattgtatg |
27297218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 28195207 - 28195161
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
28195161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 33233295 - 33233249
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatg |
33233249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 41509517 - 41509559
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
41509559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 44857307 - 44857261
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
44857261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 5062294 - 5062339
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 246
Target Start/End: Original strand, 5474902 - 5474947
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
5474902 |
tatccccgtgagcttagctcagttggcagggatattgcatattata |
5474947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 36182644 - 36182685
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
36182685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 41566760 - 41566805
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatg |
41566805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 2806571 - 2806527
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggatattgtatattatatgt |
2806527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 6636034 - 6635994
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatg |
6635994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 19612715 - 19612759
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattatatgt |
19612759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 209 - 249
Target Start/End: Complemental strand, 30392898 - 30392858
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgt |
30392858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 33669732 - 33669780
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
33669732 |
tatccccgtgagcttaactcagttagtagggatattgcatattatatgt |
33669780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 466680 - 466633
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||| ||||||||||| |
|
|
| T |
466680 |
tatccccgtgagcatagctcagttggtagggatattacatattatatg |
466633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 1071466 - 1071513
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
1071466 |
tatccccgtgagcttagctcagttggtatggatattgtatattatatg |
1071513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 18803207 - 18803254
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
18803207 |
tatccccgtgagcttagctcacttggtaggaatattgcatattatatg |
18803254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 27497602 - 27497555
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
27497602 |
tatccccgtgagcatagctcagttggtagggatattgcatgttatatg |
27497555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 27913539 - 27913496
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattatatg |
27913496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 32609261 - 32609214
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
32609261 |
tatctccgtgagcttaactcagttggtagggatattgcatattatatg |
32609214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 33041937 - 33041890
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33041937 |
tatccccgtgagtttaactcagttggtagggatattgcatattatatg |
33041890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 206 - 249
Target Start/End: Complemental strand, 40363140 - 40363097
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatgt |
40363097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 44822419 - 44822466
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
44822419 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
44822466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 3287129 - 3287083
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
3287129 |
atccctgtgagcttagctcagttggaagggatattgcatattatatg |
3287083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 7379673 - 7379627
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
7379673 |
atccccgtgagcttaactcagttggtaaggatattgcatattatatg |
7379627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 247
Target Start/End: Original strand, 8322810 - 8322848
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8322810 |
tgagcttagttcagttggtaggggtattgcatattatat |
8322848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 17487705 - 17487747
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatg |
17487747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 20296415 - 20296461
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||||||||||| |
|
|
| T |
20296415 |
atccccgtgagcttagctcagttgataaggatattgcatattatatg |
20296461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 28194629 - 28194675
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
28194629 |
atccccatgagcttagctcagttgctagggatattgcatattatatg |
28194675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 38525626 - 38525580
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| ||||||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatg |
38525580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 23405194 - 23405239
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatg |
23405239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Original strand, 32168931 - 32168972
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatgt |
32168972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 5612957 - 5612997
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
5612957 |
gtgagcttagctcagttggcagggatattgcatattatatg |
5612997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 8742894 - 8742850
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatattatatgt |
8742850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 28153217 - 28153169
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
28153217 |
gtatcccagtgagcttaactcagttggtagggatattgcatgttatatg |
28153169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 44658329 - 44658373
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
44658329 |
ccccgtgagcttagctcagttagtaggaatattgcatattatatg |
44658373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 7907617 - 7907570
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| | | ||||||||| |||||||||||||||| |
|
|
| T |
7907617 |
tatccccgtgagcttagtttaattggtagggatattgcatattatatg |
7907570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 20898123 - 20898080
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
20898123 |
cccgtgaacttaactcagttggtaggggtattgcatattttatg |
20898080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 27449183 - 27449226
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
27449183 |
cccgtgagcatagctcagttggtagggatattgcattttatatg |
27449226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 206 - 249
Target Start/End: Complemental strand, 29772347 - 29772304
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatgt |
29772304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 30390439 - 30390396
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
30390439 |
cccgtgaatttagctcagttggtagggatattgcatattatatg |
30390396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 31223624 - 31223663
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatg |
31223663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 33549128 - 33549081
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||| | ||||| |||||||||| |
|
|
| T |
33549128 |
tatccccgtgagcttagctcagttgatagagatattgtatattatatg |
33549081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 35798100 - 35798053
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||| ||| | |||||||||||||||| |
|
|
| T |
35798100 |
tatccccgtgagcttaactcagttgttagagatattgcatattatatg |
35798053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 36005438 - 36005485
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| || |||| ||||||||| |||||||||||||||| |
|
|
| T |
36005438 |
tatccccgtgagcgtaactcaattggtagggatattgcatattatatg |
36005485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 38179319 - 38179272
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| |||||||| ||||||| |
|
|
| T |
38179319 |
tatccctgtgagtttagctcagttggtagggatattgcattttatatg |
38179272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 38557297 - 38557250
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||| ||||||| |
|
|
| T |
38557297 |
tatccccgtgagcttaactcagttggtagggatatggcattttatatg |
38557250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 43936697 - 43936744
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
43936697 |
tatctccgtgagcttagctcagttggtagggatatcgcattttatatg |
43936744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 44021069 - 44021116
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
44021069 |
gtatccccgtgagcttaactcagttggtaggaatattgcatgttatat |
44021116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Original strand, 1500970 - 1501004
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
1500970 |
ttagctcagttggtagggatattgcatattatatg |
1501004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 3301811 - 3301853
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
3301811 |
cccgtgagcttagctcatttggtagggatattgcattttatat |
3301853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 7281757 - 7281715
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| | |||||||||||||||| |||||||||||||||| |
|
|
| T |
7281757 |
ccgtgagttaagctcagttggtagggatattgcatattatatg |
7281715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 19958097 - 19958135
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtagggacattgcata |
19958135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 20919608 - 20919646
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtagggacattgcata |
20919646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 22718134 - 22718088
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| || || |||||||||| |
|
|
| T |
22718134 |
atccccgtgagcttaactcagttggtagggatactgtatattatatg |
22718088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 27016273 - 27016319
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| |||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
27016273 |
tatcaccgtgagcttagttcagttggtatggatattgcatattatat |
27016319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 41286132 - 41286174
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
41286132 |
ccgtgagcttggttcagttggtagggatattgcatattatatg |
41286174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 241
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 43895910 - 43895956
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
43895910 |
atccccgtgagcttagctcagttggtagggatatcacattttatatg |
43895956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 8763379 - 8763424
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||| |||||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttatat |
8763424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 33222221 - 33222180
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
33222221 |
gtgaacttaactcagttggtagggatattgcatattatatgt |
33222180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 40864401 - 40864442
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40864401 |
cgtgagcttagctcagttggtaggaatattgcattttatatg |
40864442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 4878205 - 4878253
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||| |||| |||| ||||| ||||||||||| |
|
|
| T |
4878205 |
tatccccgtgagtttagctcacttggcagggatattgtatattatatgt |
4878253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 10463270 - 10463242
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10463270 |
tccccgtgagcttagctcagttggtaggg |
10463242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 245
Target Start/End: Complemental strand, 11144288 - 11144244
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
11144288 |
tatccccgtgagtttagctcagttggtagaaatattgcatattat |
11144244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 245
Target Start/End: Original strand, 16040237 - 16040281
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
16040237 |
tatcctcgtgagcttagttcagttggtagggatattgcatgttat |
16040281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 23919544 - 23919504
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23919544 |
gtgagcttagctcagttggtagggacattgcataatatatg |
23919504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 29942193 - 29942153
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatg |
29942153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 37063523 - 37063563
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37063523 |
gtgatcttacctcagttggtagggatattgcatattatatg |
37063563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 37352560 - 37352520
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37352560 |
gtgagtttaactcagttggtagggatattgcatattatatg |
37352520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 41939176 - 41939128
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
41939176 |
tatcctcgtgagcttagcttagttggtagggataatgcataatatatgt |
41939128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 241
Target Start/End: Original strand, 43146348 - 43146388
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
43146348 |
tatccccgtgagtttaactcagttggtagggatattgcata |
43146388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 44898557 - 44898509
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
44898557 |
gtatcctcgtgaggttaactcagttggtaggaatattgcatattatatg |
44898509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 95)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 10244963 - 10244915
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10244963 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
10244915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 19753043 - 19752995
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19753043 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
19752995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 47641041 - 47641089
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47641041 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
47641089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 2681092 - 2681139
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2681092 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
2681139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 9877341 - 9877294
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9877341 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
9877294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 15238885 - 15238932
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15238885 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
15238932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 29617401 - 29617448
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29617401 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
29617448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 35950124 - 35950171
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35950124 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
35950171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 37300172 - 37300125
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
37300125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 44616598 - 44616645
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44616598 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
44616645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 47999777 - 47999824
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
47999824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 2228972 - 2229018
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
2229018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 12640662 - 12640616
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12640616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 23102631 - 23102585
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
23102585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 25833552 - 25833598
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
25833598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 42443686 - 42443732
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42443732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 5990219 - 5990172
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5990219 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatg |
5990172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 21066883 - 21066930
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgt |
21066930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 24061403 - 24061356
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24061403 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatg |
24061356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 24781030 - 24781073
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
24781073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 27510327 - 27510284
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
27510284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 30940767 - 30940814
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
30940767 |
tatccccgtgagcttagctcagttggtagtgatattgcatattatatg |
30940814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 36391974 - 36391931
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
36391931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 3766808 - 3766854
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
3766854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 12772112 - 12772158
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12772112 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatg |
12772158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 27424836 - 27424882
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatg |
27424882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 30806112 - 30806158
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
30806158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 31026216 - 31026262
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
31026262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 36174391 - 36174433
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
36174433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 38889566 - 38889520
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
38889520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 41084040 - 41084082
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
41084082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 42182267 - 42182225
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatg |
42182225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 46534821 - 46534775
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattatatg |
46534775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 30388575 - 30388534
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
30388534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 39098130 - 39098179
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
39098130 |
tgtatccctgtgagcttagttcagttggtagggatattgcatattatatg |
39098179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 18223787 - 18223743
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattatatgt |
18223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 24062081 - 24062037
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattatatgt |
24062037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 24692470 - 24692518
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| |||| |
|
|
| T |
24692470 |
gtatccccgtgaggttagctcagttggtagggatattgcatattctatg |
24692518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 36720109 - 36720149
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatat |
36720149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 48119465 - 48119513
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
48119465 |
gtatccctgtgagcttagctcagttggtagggatattgcattttatatg |
48119513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 9929978 - 9929931
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
9929978 |
tatccccgttagcttagctcagttggtagggatattgaatattatatg |
9929931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 15106765 - 15106718
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
15106765 |
tatcccggtgagcttaactcagttggtagggatattgcatattatatg |
15106718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 29625917 - 29625964
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
29625917 |
tatccacgtgagcttaactcagttggtagggatattgcatattatatg |
29625964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 32677008 - 32676969
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatg |
32676969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 32984284 - 32984245
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatat |
32984245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 34267621 - 34267578
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattatatg |
34267578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 35815834 - 35815881
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
35815834 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
35815881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 36389740 - 36389693
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
36389740 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatg |
36389693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 36469779 - 36469736
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
36469779 |
tatccccgtgagcttagctcagttggtagggatattacatatta |
36469736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 41465834 - 41465877
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattatatg |
41465877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 9712267 - 9712225
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
9712225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21388520 - 21388566
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
21388520 |
atccccatgagcgtagctcagttggtagggatattgcatattatatg |
21388566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 33996954 - 33996908
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
33996954 |
atccccgtgagtatagctcagttggtagggatattgcatattatatg |
33996908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 36622171 - 36622217
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatg |
36622217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 48288470 - 48288428
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
48288428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 247
Target Start/End: Original strand, 3529773 - 3529822
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| |||||||| |||||| |
|
|
| T |
3529773 |
ttgtatccccgtgagtttaactcagttggtagggatattgcattttatat |
3529822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 5833037 - 5833082
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatg |
5833082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 24732618 - 24732577
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatgt |
24732577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 26816730 - 26816685
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatg |
26816685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 9497962 - 9498010
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
9497962 |
tatccccgcgagtttagctcaattggtagggatattgcatattatatgt |
9498010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 12615746 - 12615794
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
12615746 |
gtatccccttgagcttaactcagttgatagggatattgcatattatatg |
12615794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 249
Target Start/End: Original strand, 41699631 - 41699683
Alignment:
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| ||| ||||||||||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
41699631 |
gttgaatctccgtgagcttagctcagttagtagggatattgcatatcatatgt |
41699683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 4960788 - 4960827
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatg |
4960827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 5073263 - 5073310
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
5073263 |
tatccccgtgagcttaactcagttggtagagatattgtatattatatg |
5073310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 9233836 - 9233789
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| || ||||||| |
|
|
| T |
9233836 |
tatccccgtgagcttaactcagttggtagggatattgaattttatatg |
9233789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 12264050 - 12264097
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
12264050 |
tatctccgtgaacttagctcagttggtagggatattgcattttatatg |
12264097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 15694546 - 15694593
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
15694546 |
tatccccgtgagcttaattcagttggtagggatattgtatattatatg |
15694593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 15701526 - 15701573
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
15701526 |
tatccccgtgagcttaattcagttggtagggatattgtatattatatg |
15701573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 19922169 - 19922122
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||| |||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatgt |
19922122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 21762966 - 21762919
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||| ||||||||||| || |||||||||||||||| |
|
|
| T |
21762966 |
tatccccgtgaacttatctcagttggtaaggatattgcatattatatg |
21762919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 23755088 - 23755041
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
23755088 |
tatccccgtgagcttagctcaatcggtagggatattgcatattttatg |
23755041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 24508822 - 24508869
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24508822 |
tatcccagtgagcgtagttcagttggtagggatattgcatattatatg |
24508869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 24880526 - 24880479
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
24880526 |
tatctccgtaagcttagctcagttggtagggatattgaatattatatg |
24880479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 26801803 - 26801756
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
26801803 |
tatccccgtgagtatagctcagttggtaggaatattgcatattatatg |
26801756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 27704373 - 27704326
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
27704373 |
tatccccgtgaacttaactcagttggtaggaatattgcatattatatg |
27704326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 28805304 - 28805343
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatg |
28805343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 32074469 - 32074422
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
32074469 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatg |
32074422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 32619347 - 32619394
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| |||||||| || || ||||||||||||||||| |
|
|
| T |
32619347 |
atccccgtgagcttaactcagttgttaaggatattgcatattatatgt |
32619394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 35645595 - 35645642
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
35645595 |
tatccccatgagcgtagctcagttggtagggatattgtatattatatg |
35645642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 35683197 - 35683154
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggatatcgcattttatatg |
35683154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 38824699 - 38824652
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
38824699 |
tatctccgtgagcttagctcagttgatagggatattgcgtattatatg |
38824652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 3392465 - 3392511
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||| |||||||| || || ||||||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatgt |
3392511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7525441 - 7525487
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||| |||||||||| || |||||||||||||||| |
|
|
| T |
7525441 |
atccccgtgagtttagttcagttggtaaggatattgcatattatatg |
7525487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 10226672 - 10226718
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||| ||||||||||||| | |||||||||||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatg |
10226718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 12364745 - 12364791
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||| ||||||||| |
|
|
| T |
12364745 |
tatccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 13720767 - 13720813
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
13720767 |
atccccgtgaagttagctcagttggttgggatattgcatattatatg |
13720813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 24188471 - 24188513
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcatattatatg |
24188513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 27679083 - 27679037
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
27679083 |
atcctcgtgagcttaactcagttggtatggatattgcatattatatg |
27679037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 36114414 - 36114368
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
36114414 |
atccccgtaagcttaactcagttaataggggtattgcatattatatg |
36114368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 203 - 249
Target Start/End: Complemental strand, 40518961 - 40518915
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40518961 |
tccccgtgaacttagctcagttggtagggacattgcataatatatgt |
40518915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 10691 - 10650
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
10691 |
cgtgatcttagcttagttggtagggatattgcatattatatg |
10650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 13730164 - 13730124
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatg |
13730124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 240
Target Start/End: Original strand, 38151347 - 38151379
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
38151347 |
gtgagcttagctcagttggtagggatattgcat |
38151379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 241
Target Start/End: Complemental strand, 47543042 - 47543010
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
47543042 |
tgagcttagctcagttggtaggggcattgcata |
47543010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 104)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 4417760 - 4417712
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4417760 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
4417712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 12891553 - 12891601
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12891553 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgt |
12891601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 27765252 - 27765300
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27765252 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
27765300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 1743123 - 1743170
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1743123 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
1743170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 11897244 - 11897291
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11897244 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
11897291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 16603394 - 16603441
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16603394 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
16603441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 17545246 - 17545199
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17545246 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
17545199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 42320313 - 42320360
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42320313 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
42320360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 6518849 - 6518803
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
6518803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 9835030 - 9835076
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9835076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 12463753 - 12463799
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
12463799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21918049 - 21918095
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
21918095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 32505685 - 32505731
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
32505731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 41179876 - 41179830
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
41179830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 2848208 - 2848256
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
2848208 |
gtatccccgtgagcttagctcagttggtagggatattgtatattatatg |
2848256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 4745947 - 4745903
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
4745903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 25472654 - 25472610
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
25472610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 39886286 - 39886238
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39886286 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgt |
39886238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 6558797 - 6558844
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
6558797 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatg |
6558844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 8241046 - 8241093
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8241046 |
tatccccatgagcttagctcagttggtagggatattgcatattatatg |
8241093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 8968745 - 8968792
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8968745 |
tatctccgtgagcttagctcagttggtagggatattgcatattatatg |
8968792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 9125659 - 9125706
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
9125659 |
tatccccgtgagcttagctcagttggtagcgatattgcatattatatg |
9125706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 13622020 - 13621973
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
13622020 |
tatccccgtgagcttagctcagttggtagggatatcgcatattatatg |
13621973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 25648159 - 25648116
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25648159 |
tatccccgtgagcttagctcagttggtagggatattgcatatta |
25648116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 35515512 - 35515555
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
35515555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 39919167 - 39919120
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
39919167 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatg |
39919120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 2328589 - 2328635
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
2328635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 5900289 - 5900335
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
5900335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 5966826 - 5966872
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
5966872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 12767961 - 12768007
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
12768007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 18815345 - 18815391
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatg |
18815391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 21749450 - 21749404
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatg |
21749404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 29713449 - 29713403
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatg |
29713403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 32706319 - 32706365
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
32706365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 36888468 - 36888422
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
36888422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 40091474 - 40091520
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
40091520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 42525397 - 42525443
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
42525443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 11774534 - 11774486
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
11774534 |
gtatccccgtgaccttagctcagtttgtagggatattgcatattatatg |
11774486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8478967 - 8478920
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
8478967 |
tatccccgtgagtttagttcagttggtagggatattgcatattatatg |
8478920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 16386807 - 16386768
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatg |
16386768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 17666006 - 17666049
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17666006 |
cccgtgagcttagctcagttggtaggaatattgcatattatatg |
17666049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 23292487 - 23292444
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttatatg |
23292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 25729514 - 25729467
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
25729514 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
25729467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 26912830 - 26912877
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatgt |
26912877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 27798617 - 27798664
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
27798617 |
tatccctgtgagcatagctcagttggtagggatattgcatattatatg |
27798664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 33736088 - 33736041
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
33736088 |
tatccccgggagcttaactcagttggtagggatattgcatattatatg |
33736041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 41477432 - 41477385
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
41477432 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatg |
41477385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 42916385 - 42916432
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
42916385 |
tatccccgtgagcttagctcagttggtagggatattgtatgttatatg |
42916432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 43580878 - 43580921
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43580878 |
cccgtgaacttagctcagttggtagggatattgcatattatatg |
43580921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 546803 - 546845
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
546845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 831589 - 831635
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatg |
831635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 1269240 - 1269194
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatattatatg |
1269194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 10241726 - 10241768
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
10241726 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
10241768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 15241393 - 15241439
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
15241393 |
atccccgtgagcttagctcagttgataggaatattgcatattatatg |
15241439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 200 - 246
Target Start/End: Original strand, 16971617 - 16971663
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| |||||||| |
|
|
| T |
16971617 |
gtatccccgtgagcttagctcagttggtagagatattgtatattata |
16971663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 24033074 - 24033120
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24033074 |
atccccgcgagcttagctcagttggtagggatattgcattttatatg |
24033120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 40361648 - 40361606
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatg |
40361606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 2362971 - 2363012
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
2363012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 3198325 - 3198370
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatg |
3198370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 6414070 - 6414111
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatg |
6414111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 22569317 - 22569272
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22569317 |
atccctgtgagcttagctcagttggtaggcatattgcatattatat |
22569272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 208 - 249
Target Start/End: Original strand, 29154846 - 29154887
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgt |
29154887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 11188753 - 11188709
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
11188753 |
ccccgtgagcttagctcagttgataggaatattgcatattatatg |
11188709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 11786135 - 11786087
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
11786135 |
gtatctccgtgagcttaactcagttggtagggatattgcattttatatg |
11786087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 16891348 - 16891388
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
16891348 |
cgtgagcttagctcagttggtagggatattgcattttatat |
16891388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 20719734 - 20719782
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||| |||||||| |
|
|
| T |
20719734 |
tatccccgtgagcttagatctgttggtagggatattgcattttatatgt |
20719782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 25400434 - 25400394
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatg |
25400394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 35113037 - 35112989
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
35113037 |
gtattcccgtgagcttagttcagttgatagggatattgcatattatatg |
35112989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 988711 - 988758
Alignment:
| Q |
202 |
atccccgtgagcttagctcagtt-ggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
988711 |
atccccgtgagcttaactcagtttggtagggatattgcatattatatg |
988758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 1469726 - 1469769
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatgt |
1469769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 3712140 - 3712093
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
3712140 |
tatccccgtaagcttagctcagttggtagagatattgcattttatatg |
3712093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 6526046 - 6526093
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||| | ||||| |||||||||| |
|
|
| T |
6526046 |
tatccccgtgagtttagctcagttggtagagatattggatattatatg |
6526093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 8750971 - 8750928
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
8750971 |
cccgtgagcttagttaagttggtagggatattgcatattatatg |
8750928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 11146602 - 11146555
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||| |||||||| |
|
|
| T |
11146602 |
atccccgtgagcttagctcagttgataaggatattgcatgttatatgt |
11146555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 14641179 - 14641136
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatg |
14641136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 17064932 - 17064885
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
17064932 |
tatcctcgtgagcttaactcaattggtagggatattgcatattatatg |
17064885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 19985500 - 19985543
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
19985500 |
cccgtgaccttagctcagttggtagggatattgcataatatatg |
19985543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 31074200 - 31074153
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||| ||| |||||||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatgt |
31074153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 36124395 - 36124442
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
36124395 |
tatctccgtgagcttagctcagttgataggaatattgcatattatatg |
36124442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 39165013 - 39165060
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
39165013 |
tatctccgtgagtttagttcagttggtagggatattgcatattatatg |
39165060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 42885830 - 42885873
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatgt |
42885873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Original strand, 13956898 - 13956928
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13956898 |
tatccccgtgagcttagctcagttggtaggg |
13956928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 244
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 21962178 - 21962132
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| ||||||||| |||| ||||||| |||||||| |
|
|
| T |
21962178 |
atccccgtgagcttaactcagttggcagggatattgcaaattatatg |
21962132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 24132934 - 24132980
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||||| ||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgcgtattatatg |
24132980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Original strand, 28308243 - 28308277
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
28308243 |
ttagctcagttggtagggatattgcatattatatg |
28308277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 32423562 - 32423608
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
32423562 |
atccccgtgagcttaactcagttgttagggatattgtatattatatg |
32423608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 35241397 - 35241439
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
35241397 |
ccgtgagcttagttcagttggtagagatattgcatattatatg |
35241439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 40081875 - 40081921
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||| ||| ||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatg |
40081921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 42158882 - 42158924
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
42158882 |
cccgtgaacttagctcagtttgtagggatattgcatattatat |
42158924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 4067980 - 4068025
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatg |
4068025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 248
Target Start/End: Original strand, 10404133 - 10404170
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatg |
10404170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 241
Target Start/End: Original strand, 18928723 - 18928756
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
18928723 |
gtgagcttagctcagttggtagggatattgcata |
18928756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Original strand, 30571164 - 30571197
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
30571164 |
tagctcagttggtagggatattgcatattatatg |
30571197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 33433992 - 33433947
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
33433992 |
atccccgtgaacttagctcagttggtagaaatattgcatattatat |
33433947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 39028101 - 39028060
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
39028101 |
cgtgagattagctcatttggtagggatattgcatattatatg |
39028060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 40276510 - 40276469
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
40276510 |
cgtgagtttagctcagttggtaggaatattgcatattatatg |
40276469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 4393851 - 4393899
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||| ||||||||||||| | |||||| ||||||| |
|
|
| T |
4393851 |
gtatctccgtgagcttagttcagttggtagggatgttgcattttatatg |
4393899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 6119866 - 6119906
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
6119866 |
gtgagcttagctcagttggaagggatattgcattttatatg |
6119906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 11017168 - 11017216
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| || |||||| |||||| |
|
|
| T |
11017168 |
gtatccgcgtgagtttagctcagttggtagggataatgcataatatatg |
11017216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcata |
241 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 247
Target Start/End: Complemental strand, 20370192 - 20370152
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
20370192 |
cgtgagcttagctcagttggtagggataatgcataatatat |
20370152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 29045890 - 29045930
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
29045890 |
gtgagtttagttcagttggtagggatattgcatattatatg |
29045930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 134)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 43596890 - 43596938
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43596890 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
43596938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 26868345 - 26868392
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26868345 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
26868392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 26919542 - 26919495
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26919542 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
26919495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 39023171 - 39023218
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39023171 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
39023218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 40051619 - 40051666
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
40051666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 46775104 - 46775057
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46775104 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
46775057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 48569250 - 48569203
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48569250 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
48569203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 49901478 - 49901525
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49901478 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
49901525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 3847678 - 3847724
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
3847724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 6371111 - 6371157
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
6371157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8965091 - 8965137
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
8965137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 24680159 - 24680113
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
24680113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 37935858 - 37935904
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
37935904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 43147457 - 43147411
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43147411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 43207666 - 43207712
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
43207712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 248
Target Start/End: Original strand, 45126125 - 45126175
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
45126125 |
ttgtatccccgtgagcttagctcagttggtagggatattgtatattatatg |
45126175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 46105532 - 46105578
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
46105578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 248
Target Start/End: Complemental strand, 55238576 - 55238526
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
55238576 |
ttgtatccccgtgagcttagcttagttggtagggatattgcatattatatg |
55238526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 55251424 - 55251378
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
55251378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 8433696 - 8433651
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatat |
8433651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 11375965 - 11375916
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
11375965 |
tgtatccccgtgagcttagctcagttgatagggatattgcatattatatg |
11375916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 200 - 249
Target Start/End: Complemental strand, 31852688 - 31852639
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31852688 |
gtatccccgtgagcttatctcagttggtagggttattgcatattatatgt |
31852639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 40994173 - 40994129
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattatatgt |
40994129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 4234359 - 4234312
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
4234359 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatg |
4234312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 22230504 - 22230461
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
22230461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 22788744 - 22788701
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
22788701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 244
Target Start/End: Complemental strand, 35219574 - 35219531
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35219574 |
tatccccgtgagcttagctcagttggtagggatattgcatatta |
35219531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 43978008 - 43978051
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
43978051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 45849043 - 45849090
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
45849043 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatg |
45849090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 51512083 - 51512036
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
51512083 |
tatccccgtgagctgagctcagttggtagggatattgcatattatatg |
51512036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 52798274 - 52798321
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
52798274 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatg |
52798321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 55853182 - 55853135
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
55853182 |
tatccccgtgagcttagctcagttggtagagatattgcatattatatg |
55853135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 3036128 - 3036082
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
3036082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 3764081 - 3764035
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatattatatg |
3764035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 4590242 - 4590288
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4590242 |
tatccccgtgagtttagctcagttggtagggatattgcatattatat |
4590288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 4958629 - 4958583
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
4958583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 9761112 - 9761158
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatg |
9761158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 244
Target Start/End: Complemental strand, 23705226 - 23705184
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
23705184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 25235870 - 25235824
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatattatatg |
25235824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 30217600 - 30217642
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
30217642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 206 - 248
Target Start/End: Original strand, 34353780 - 34353822
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatg |
34353822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 39696405 - 39696363
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
39696363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 44602482 - 44602528
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
44602528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 45112184 - 45112138
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatattatatg |
45112138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 198 - 248
Target Start/End: Original strand, 46582627 - 46582677
Alignment:
| Q |
198 |
ttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
46582627 |
ttgtatccctgtgagtttagctcagttggtagggatattgcatattatatg |
46582677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 47934145 - 47934099
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatattatatg |
47934099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 55536377 - 55536423
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatg |
55536423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 35465432 - 35465477
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatat |
35465477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 246
Target Start/End: Original strand, 42218746 - 42218791
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
42218746 |
tatccccgtgaacttagctcagttggtagggatattgcatattata |
42218791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 48798276 - 48798320
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata |
48798320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 3157291 - 3157244
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
3157291 |
tatccccgtgaacttagctcagttggtaggaatattgcatattatatg |
3157244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 3815060 - 3815103
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattatatg |
3815103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 5165853 - 5165900
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
5165853 |
tatccccgtgagcttaactcagttggtagggatatcgcatattatatg |
5165900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 7686336 - 7686289
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
7686336 |
tatccccgtgagcttagctcagttggtagagatattgcattttatatg |
7686289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 13264348 - 13264301
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
13264348 |
tatccccatgagcttcgctcagttggtagggatattgcatattatatg |
13264301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 27743778 - 27743735
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattatatg |
27743735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 39697932 - 39697889
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattatatg |
39697889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 248
Target Start/End: Original strand, 45673644 - 45673695
Alignment:
| Q |
197 |
gttgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
45673644 |
gttgcatccccgtgagcttaactcagttggtaggaatattgcatattatatg |
45673695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 49447118 - 49447165
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
49447118 |
atccccatgagcttagctcagttggtaaggatattgcatattatatgt |
49447165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 50457784 - 50457741
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
50457784 |
cccgtgagcttagctcagttggtaaggatattgcatattatatg |
50457741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 52757352 - 52757305
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
52757352 |
tatccccgtgagcttagctcagttggcaggaatattgcatattatatg |
52757305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 637096 - 637142
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatg |
637142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 1458091 - 1458045
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
1458091 |
atccccgtaagcttagctcagttgatagggatattgcatattatatg |
1458045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 10402438 - 10402484
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatg |
10402484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 10417294 - 10417248
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
10417294 |
atccccatgagcttagctcagttggtagggatattacatattatatg |
10417248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 12504716 - 12504670
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
12504716 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatg |
12504670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 13578534 - 13578492
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
13578492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 21935474 - 21935520
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21935474 |
atccccgcaagcttagctcagttggtagggatattgcatattatatg |
21935520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 203 - 249
Target Start/End: Original strand, 42395225 - 42395271
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
42395225 |
tccctgtgagcttagcttagttggtagggatattgcatattatatgt |
42395271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 49757357 - 49757311
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
49757357 |
atccccgtgagcatagctcagttggtaggaatattgcatattatatg |
49757311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 50512357 - 50512403
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50512357 |
atccccatgagcttagctcagttggtaggaatattgcatattatatg |
50512403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 922321 - 922276
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
922321 |
atccccgtaagtttagctcagttggtagaggtattgcatattatat |
922276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 25726378 - 25726337
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25726378 |
ccgtgggcttagctcagttggtagggatattgcatattatat |
25726337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 29771367 - 29771326
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatg |
29771326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Complemental strand, 33933811 - 33933766
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatg |
33933766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 35207227 - 35207178
Alignment:
| Q |
199 |
tgtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
35207227 |
tgtatctccgtgagcttaactcagttgatagggatattgcatattatatg |
35207178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 37251111 - 37251156
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatg |
37251156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 627049 - 627009
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatg |
627009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 18424967 - 18424923
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
18424967 |
cccgtgaacttaactcagttggtagggatattgcatattatatgt |
18424923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 245
Target Start/End: Complemental strand, 24997504 - 24997464
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 27103175 - 27103127
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| ||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27103175 |
tatctccgtgtgcttagcttagttggtagggatattgcatattatatgt |
27103127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 29329897 - 29329849
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
29329897 |
tatccccgtgagcttagctcagttggtaggaatattgtattttatatgt |
29329849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 42381183 - 42381139
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
42381183 |
cccgtgaacttagctcagttggtagggatattgcatgttatatgt |
42381139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 52483250 - 52483203
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| || | ||||||||||||||| |
|
|
| T |
52483250 |
tatccccgtgagcttagctcagttggta-ggatgttgcatattatatgt |
52483203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 56360786 - 56360738
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |||||||||| |
|
|
| T |
56360786 |
tatccccgtgaatttagctcagttggtagggatattgcgtattatatgt |
56360738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 4105727 - 4105770
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
4105727 |
cccgtgagcttagctcagttgatagggatattgcattttatatg |
4105770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 4357879 - 4357926
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
4357879 |
atccccgtgaacttagctcagttggtagagatattgtatattatatgt |
4357926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 247
Target Start/End: Complemental strand, 8848279 - 8848240
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
8848279 |
gtgagcttagttcagttggtagggatattgcatattatat |
8848240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 12167690 - 12167643
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
12167690 |
tatccctgtgaacttaactcagttggtagggatattgcatattatatg |
12167643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 15604110 - 15604067
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggatgttgcattttatatg |
15604067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 18360489 - 18360536
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
18360489 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatg |
18360536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 23787413 - 23787366
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
23787413 |
tatccctgtgagcataactcagttggtagggatattgcatattatatg |
23787366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 33530790 - 33530837
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| ||||||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
33530790 |
atcctcgtgagcttagcttaattggtagggatattgcatattatatgt |
33530837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 36602440 - 36602393
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
| T |
36602440 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatg |
36602393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 38228438 - 38228481
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
38228438 |
ccgtgagcttagatcagttggtagggatattgcatgttatatgt |
38228481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 42231512 - 42231555
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
42231512 |
cccgtgagcttaactcagttggtaggaatattgcatattatatg |
42231555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 44312854 - 44312811
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
44312854 |
cccgcgagcttagctcagttggtagggatattgcattttatatg |
44312811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 48615542 - 48615499
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
48615542 |
cccgtgagcataactcagttggtagggatattgcatattatatg |
48615499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 53376753 - 53376706
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
53376753 |
tatccccgcgagcttagctcaattggtagggatattgcatgttatatg |
53376706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 542883 - 542841
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatg |
542841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 5179955 - 5179909
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||| ||||||||||| || |||||||||||||||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatg |
5179909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 36132226 - 36132272
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||||||||||||||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatg |
36132272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 43271786 - 43271744
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatg |
43271744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 43481112 - 43481066
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
43481112 |
atccccgtgagcttaactcagttggtagggatattgcactttatatg |
43481066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 231
Target Start/End: Original strand, 48949649 - 48949679
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48949649 |
tatccccgtgagcttagctcagttggtaggg |
48949679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 50442814 - 50442768
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
50442814 |
atccctgtgagcttagctcagttggtagggataatgcataatatatg |
50442768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 53572396 - 53572354
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatg |
53572354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Original strand, 54534835 - 54534869
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
54534835 |
ttagctcagttggtagggatattgcatattatatg |
54534869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 56088027 - 56087981
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
56088027 |
atccccataagcttagctcagttggtagggatattgcattttatatg |
56087981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 10407101 - 10407061
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggta-ggatattgcatattatatgt |
10407061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 12763753 - 12763798
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||| | ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
12763753 |
atccccgtaaacttagctcagttgctagggatattgcatattatat |
12763798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 15064270 - 15064229
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
15064270 |
cgtgagtttagctcagttggtaggaatattgcatattatatg |
15064229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 17872084 - 17872129
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||| ||||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcatagtatat |
17872129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 20203428 - 20203469
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatg |
20203469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 21380256 - 21380211
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||| |||||||||||||| |
|
|
| T |
21380256 |
tatccccgtgagtttagctcaattgctagggatattgcatattata |
21380211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Original strand, 30057232 - 30057265
Alignment:
| Q |
215 |
tagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
30057232 |
tagctcagttggtagggatattgcatattatatg |
30057265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 37700672 - 37700627
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||| ||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
37700672 |
atccccgtgagtttacctcggttggtagggatattgcatattatat |
37700627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 53634324 - 53634279
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||| ||||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
53634324 |
atccccatgagcttagttcagttcgtagggatattgcatattatat |
53634279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 55055914 - 55055959
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtagggacaatgcatattttatg |
55055959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 56479294 - 56479253
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
56479294 |
cgtgaacttaactcagttggtagggatattgcatattatatg |
56479253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 921553 - 921505
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| |||||||||||||||| ||| | || |||||||||||||| |
|
|
| T |
921553 |
tatccccgcgagcttagctcagttgatagagataatgcatattatatgt |
921505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 3161019 - 3161047
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3161019 |
tccccgtgagcttagctcagttggtaggg |
3161047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 249
Target Start/End: Complemental strand, 8144653 - 8144617
Alignment:
| Q |
213 |
cttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
8144653 |
cttagctcagtttgtagggatattgcatattatatgt |
8144617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 9661550 - 9661594
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| ||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
9661550 |
cccgtgagtttatctcagttggtatggatattgcatattatatgt |
9661594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 17815492 - 17815452
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
17815492 |
gtgagcttagttcagttggtagggatattacatattatatg |
17815452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 25175197 - 25175157
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
25175197 |
gtgagcttagttcagttggtagggatattacatattatatg |
25175157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 249
Target Start/End: Original strand, 25526447 - 25526487
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
25526447 |
tgagcttaactcagttggtagggatattgtatattatatgt |
25526487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 249
Target Start/End: Original strand, 31016348 - 31016380
Alignment:
| Q |
217 |
gctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
31016348 |
gctcagttggtagggatattgcatattatatgt |
31016380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 32339319 - 32339367
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| || ||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
32339319 |
gtatcctcgcgagcttaactcagttgttagggatattgcatattatatg |
32339367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 46
Target Start/End: Complemental strand, 38220448 - 38220416
Alignment:
| Q |
14 |
agttcacaaaatatacaaattttgattgttttt |
46 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
38220448 |
agttcacaaaatatacaaattttgatttttttt |
38220416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 42073155 - 42073203
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||| ||||||||| ||||||| | |||||||| |||||||| |
|
|
| T |
42073155 |
tatccccgtgaacttagctcacttggtagagatattgcattttatatgt |
42073203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 49056774 - 49056818
Alignment:
| Q |
205 |
cccgtgagctta-gctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
49056774 |
cccgtgagcttaagctcagttggtagggacattgcatattatatg |
49056818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 127)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 19550501 - 19550549
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19550501 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
19550549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 40192151 - 40192199
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40192151 |
gtatccccgtgagcttagctcagttggtagggatattgcatattatatg |
40192199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 882385 - 882432
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
882385 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
882432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 2522922 - 2522969
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2522922 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
2522969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 37800685 - 37800638
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37800685 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
37800638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 40933905 - 40933858
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40933905 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
40933858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 44652056 - 44652009
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44652056 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
44652009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 45701340 - 45701387
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45701340 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
45701387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 50496888 - 50496841
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50496888 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
50496841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 53163591 - 53163638
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgt |
53163638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 53347364 - 53347317
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53347364 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
53347317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7269952 - 7269998
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7269998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 7920317 - 7920363
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
7920363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 19999864 - 19999910
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
19999910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 22502004 - 22501958
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
22501958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 28550392 - 28550346
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
28550346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 31327574 - 31327528
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
31327528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 31327791 - 31327745
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
31327745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 32144581 - 32144627
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatg |
32144627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 39966147 - 39966101
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
39966101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 40548300 - 40548346
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40548346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 52410314 - 52410268
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
52410268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 52945892 - 52945938
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
52945938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 6920034 - 6919990
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattatatg |
6919990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 25939005 - 25938957
Alignment:
| Q |
200 |
gtatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
25939005 |
gtatccccgtgagtttagctcagttggtagggatattgcatattatatg |
25938957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 196 - 244
Target Start/End: Complemental strand, 30555306 - 30555258
Alignment:
| Q |
196 |
agttgtatccccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30555306 |
agttttatccccgtgagcttagctcagttggtagggatattgcatatta |
30555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 4139000 - 4139043
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
4139043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 9176656 - 9176613
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
9176613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 10482927 - 10482880
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10482927 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatg |
10482880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 11820001 - 11820048
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgt |
11820048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 15975148 - 15975195
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15975148 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatg |
15975195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 17218484 - 17218531
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17218484 |
tatccccatgagcttagctcagttggtagggatattgcatattatatg |
17218531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 18194334 - 18194381
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
18194334 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatg |
18194381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 28689746 - 28689699
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28689746 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatg |
28689699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 30779641 - 30779594
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30779641 |
tatcctcgtgagcttagctcagttggtagggatattgcatattatatg |
30779594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 32256628 - 32256581
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
32256628 |
tatccccgtgagcttagctcagttggtagggatattgcatgttatatg |
32256581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 34898841 - 34898794
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34898841 |
tatccccgtgagcttagttcagttggtagggatattgcatattatatg |
34898794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 47098732 - 47098775
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
47098775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 48739818 - 48739771
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
48739818 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatg |
48739771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 3748675 - 3748629
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatg |
3748629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 10176976 - 10176930
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatg |
10176930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 249
Target Start/End: Complemental strand, 17602744 - 17602702
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatgt |
17602702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 19996525 - 19996479
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
19996479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 31529031 - 31528985
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatg |
31528985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 31586944 - 31586990
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31586944 |
atccccatgagcttagctcagttggtagggatattgcatattatatg |
31586990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 34102684 - 34102638
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
34102638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 41936480 - 41936434
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41936480 |
atccccgtaagcttagctcagttggtagggatattgcatattatatg |
41936434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 46796002 - 46795956
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
46795956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 50536905 - 50536859
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatattatatg |
50536859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 52974126 - 52974080
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatattatatg |
52974080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 8125641 - 8125682
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8125682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 5636866 - 5636826
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatg |
5636826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 48546173 - 48546217
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattatatgt |
48546217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 50234123 - 50234167
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattatatg |
50234167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 52670223 - 52670179
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattatatgt |
52670179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 6488120 - 6488167
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
6488120 |
tatccccatgagcttagctcaattggtagggatattgcatattatatg |
6488167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8964850 - 8964803
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
8964850 |
tatccccgtgagtttagctcagttggtagggatattgcatatcatatg |
8964803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 13638318 - 13638271
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatgt |
13638271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 20489819 - 20489858
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatg |
20489858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 26942753 - 26942796
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattatatg |
26942796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 32828441 - 32828484
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattatatg |
32828484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 34847539 - 34847586
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34847539 |
tatccccgtgagcttaattcagttggtagggatattgcatattatatg |
34847586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 248
Target Start/End: Complemental strand, 36625237 - 36625198
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatg |
36625198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 39719935 - 39719978
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
39719935 |
cccgtgagtttagctcagttggtagggatattgcatattatatg |
39719978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 44364017 - 44364064
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
44364017 |
tatccccgtgagtttaactcagttggtagggatattgcatattatatg |
44364064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 45551882 - 45551835
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
45551882 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgt |
45551835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 48251568 - 48251615
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
48251568 |
tatccctgtgagcttagctcagttgatagggatattgcatattatatg |
48251615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 49408771 - 49408818
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
49408771 |
tatccccgtgagcttagctcagctggtagggatatcgcatattatatg |
49408818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 2368933 - 2368979
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2368933 |
atcctcgtgagcttagctcagttgttagggatattgcatattatatg |
2368979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 17608392 - 17608346
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatg |
17608346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 22472387 - 22472341
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||| | |||||||||||||||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatg |
22472341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 247
Target Start/End: Original strand, 31316630 - 31316676
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
31316630 |
tatccccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 33225421 - 33225375
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
33225375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 33706800 - 33706754
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatg |
33706754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 37488533 - 37488487
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatg |
37488487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 45871014 - 45871060
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatg |
45871060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 49447135 - 49447181
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatg |
49447181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 247
Target Start/End: Complemental strand, 52046455 - 52046413
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
52046455 |
cccgtgagcttagctcagttggtagggatattgcattttatat |
52046413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 53752773 - 53752727
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatg |
53752727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 54769899 - 54769857
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
54769899 |
ccgtgagcttagcttagttggtagggatattgcatattatatg |
54769857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 211 - 248
Target Start/End: Complemental strand, 4640544 - 4640507
Alignment:
| Q |
211 |
agcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatg |
4640507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 11250659 - 11250618
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11250659 |
cgtgaacttagctcagttggtagggatattgcatattatatg |
11250618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 242
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatat |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 202 - 247
Target Start/End: Complemental strand, 44685241 - 44685196
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 49750474 - 49750433
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatg |
49750433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 242
Target Start/End: Original strand, 10349402 - 10349442
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatat |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 12894600 - 12894556
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
12894600 |
cccgtgagcttaactcagttggtagggatattgcattttatatgt |
12894556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 209 - 249
Target Start/End: Complemental strand, 29559740 - 29559700
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatgt |
29559700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 39300381 - 39300425
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata |
39300425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 45198719 - 45198767
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
45198719 |
tatctccgttagcttagttcagttggtagggatattgcatattatatgt |
45198767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 248
Target Start/End: Complemental strand, 52309181 - 52309137
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
52309181 |
ccccgtgagcttaactcagttggtagggatattgcatactatatg |
52309137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 52984013 - 52984053
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
52984013 |
gtgagcttagctcagttggtagggatattgcatattgtatg |
52984053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 53577958 - 53577998
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatg |
53577998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 54021401 - 54021361
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatg |
54021361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 1743870 - 1743823
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||| |||||||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatgt |
1743823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 3894544 - 3894587
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatattatatg |
3894587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 4541898 - 4541941
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatattatatg |
4541941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 4860161 - 4860204
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||| |
|
|
| T |
4860161 |
cccgtgagcttagctcagttggtacggatattgcattttatatg |
4860204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 4880169 - 4880212
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||| |
|
|
| T |
4880169 |
cccgtgagcttagctcagttggtacggatattgcattttatatg |
4880212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 244
Target Start/End: Complemental strand, 5326106 - 5326067
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatatta |
244 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatatta |
5326067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 24430146 - 24430189
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||| | ||||| |||||||||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatattatatg |
24430189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 25279132 - 25279085
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
25279132 |
atcctcgtgagcttagcttagttggtagggatattgtatattatatgt |
25279085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 28193794 - 28193841
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
28193794 |
tatccccttgagcttaactcagttggtagggatattgcattttatatg |
28193841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 29373519 - 29373476
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
29373519 |
cccgtgagcttaactcagttggtaaggatattgcatattatatg |
29373476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 53432811 - 53432764
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
53432811 |
tatccctgtgagtttaactcagttggtagggatattgcatattatatg |
53432764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 2390427 - 2390381
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2390427 |
atccccgtaagcgtagctcagttgatagggatattgcatattatatg |
2390381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 8762153 - 8762107
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||| ||||||||||| |
|
|
| T |
8762153 |
atccccgtgagcttaacttagttggtagggatattacatattatatg |
8762107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 11436501 - 11436547
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| ||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
11436501 |
atcctcgtgaacttaactcagttggtagggatattgcatattatatg |
11436547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 16895304 - 16895258
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
16895304 |
tatccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 40723733 - 40723687
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
40723733 |
atccccgagagcttaactcagttggtagggatattgcatgttatatg |
40723687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Complemental strand, 42108243 - 42108209
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
42108243 |
ttagctcagttggtagggatattgcatattatatg |
42108209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 201 - 247
Target Start/End: Complemental strand, 45513069 - 45513023
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||||| |||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
45513069 |
tatccccgtaagcttagctcagttagtatggatattgcatattatat |
45513023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 34740289 - 34740330
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||| ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
34740289 |
cgtgagtttagcccagttggtagggatattgcatattatatg |
34740330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 36763427 - 36763472
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
36763427 |
tccccgtgagcttggctcagttggtagggacattgcataatatatg |
36763472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 46879999 - 46880040
Alignment:
| Q |
207 |
cgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatg |
46880040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 206 - 247
Target Start/End: Complemental strand, 50675811 - 50675770
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
50675811 |
ccgtgagtttatctcagttggtagggatattgcatattatat |
50675770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 52575461 - 52575506
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
52575461 |
tccccgtgagcttagctcagttggtacgaatattgcattttatatg |
52575506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 53207965 - 53208010
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | |||||| |||||| |
|
|
| T |
53207965 |
tccccgtgagcttagctcagttggtaagggcaatgcataatatatg |
53208010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 552174 - 552214
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatg |
552214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 4200652 - 4200612
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
4200652 |
gtgaacttaactcagttggtagggatattgcatattatatg |
4200612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Complemental strand, 19591653 - 19591605
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
||||||| ||||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
19591653 |
tatccccttgagcttagctcagttgataagtatattgcatattatatgt |
19591605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 201 - 249
Target Start/End: Original strand, 21405159 - 21405207
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| |||||||| | |||||| |
|
|
| T |
21405159 |
tatccccgtgagcttacctcagttggaagggatattgcatttaatatgt |
21405207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 249
Target Start/End: Original strand, 25488885 - 25488929
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||| |||||||||||| |
|
|
| T |
25488885 |
cccgtgagcttaactcagttgttagggatattacatattatatgt |
25488929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 248
Target Start/End: Complemental strand, 40910246 - 40910207
Alignment:
| Q |
211 |
agcttagctcagttggtagggg--tattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40910246 |
agcttagctcagttggtagggggatattgcatattatatg |
40910207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 249
Target Start/End: Complemental strand, 51155158 - 51155118
Alignment:
| Q |
209 |
tgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
51155158 |
tgagcttagctcagttggtaggaatattggatattatatgt |
51155118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 247
Target Start/End: Complemental strand, 51266578 - 51266534
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggggtattgcatattatat |
247 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
51266578 |
tcccggtgagcttagctcagttggtaagggtaatgcataatatat |
51266534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 208 - 248
Target Start/End: Original strand, 51772892 - 51772932
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||| || ||||||||||| |||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatg |
51772932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 94 - 47
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
94 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
47 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 46522 - 46569
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46522 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
46569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 11990 - 12037
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11990 |
tatcctcgtgaacttagctcagttggtagggatattgcatattatatg |
12037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 59779 - 59826
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
59779 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
59826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 266771 - 266724
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
266771 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
266724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8963 - 9009
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
9009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 4087 - 4041
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
4041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 17617 - 17663
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
17663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 10899 - 10853
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
10853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 930 - 887
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 245
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 112104 - 112151
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
112104 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatg |
112151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 205 - 248
Target Start/End: Complemental strand, 12331 - 12288
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattatatg |
12288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 8899 - 8852
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
8899 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatg |
8852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Complemental strand, 2446 - 2400
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
2400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 12456 - 12502
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatg |
12502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 212 - 248
Target Start/End: Complemental strand, 13266 - 13230
Alignment:
| Q |
212 |
gcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatg |
13230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 8818 - 8864
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatg |
8864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 208 - 249
Target Start/End: Complemental strand, 65854 - 65813
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatgt |
65813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 204 - 248
Target Start/End: Original strand, 21263 - 21307
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattatatg |
21307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 3666 - 3709
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
3709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 37488 - 37441
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37488 |
tatcctcgtgagcttaactcagttggtagggatattgcatattatatg |
37441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 23361 - 23404
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23361 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
23404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 204 - 250
Target Start/End: Original strand, 5981 - 6027
Alignment:
| Q |
204 |
ccccgtgagcttagctcagttggtaggggtattgcatattatatgtg |
250 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattatatgtg |
6027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 15761 - 15807
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
15761 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatg |
15807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 212 - 248
Target Start/End: Original strand, 1871 - 1907
Alignment:
| Q |
212 |
gcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatg |
1907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 248
Target Start/End: Complemental strand, 3660 - 3620
Alignment:
| Q |
208 |
gtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3660 |
gtgagcttagctcagttggtagggatatttcatattatatg |
3620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 50071 - 50027
Alignment:
| Q |
205 |
cccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
50071 |
cccgtgagcttaactcagttgatagggatattgcatattatatgt |
50027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 245
Target Start/End: Complemental strand, 236429 - 236385
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattat |
245 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
236429 |
tatccccgtgagattagttcagttggtagggatattgcatattat |
236385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 396 - 443
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
396 |
tatccccgtgaacttagctcaattgatagggatattgcatattatatg |
443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 206 - 249
Target Start/End: Original strand, 6769 - 6812
Alignment:
| Q |
206 |
ccgtgagcttagctcagttggtaggggtattgcatattatatgt |
249 |
Q |
| |
|
|||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6769 |
ccgtgaacttaactcagttggtagggatattgcatattatatgt |
6812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 28004 - 27957
Alignment:
| Q |
201 |
tatccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
||||| |||||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
28004 |
tatcctcgtgagcttagctcggttggtagggatattgcattttatatg |
27957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Complemental strand, 11181 - 11147
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
11181 |
ttagctcagttggtagggatattgcatattatatg |
11147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Complemental strand, 21509 - 21475
Alignment:
| Q |
214 |
ttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
21509 |
ttagctcagttggtagggatattgcatattatatg |
21475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 248
Target Start/End: Original strand, 315646 - 315692
Alignment:
| Q |
202 |
atccccgtgagcttagctcagttggtaggggtattgcatattatatg |
248 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||||| ||||||| |
|
|
| T |
315646 |
atccccgtgaacttagctcagttggtaaggatattgcattttatatg |
315692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0555 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0555
Description:
Target: scaffold0555; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 203 - 231
Target Start/End: Original strand, 9309 - 9337
Alignment:
| Q |
203 |
tccccgtgagcttagctcagttggtaggg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9309 |
tccccgtgagcttagctcagttggtaggg |
9337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University