View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_high_41 (Length: 234)
Name: NF19270_high_41
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_high_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 5 - 215
Target Start/End: Original strand, 12835739 - 12835940
Alignment:
| Q |
5 |
ccatttgtaaaaacttcaccgggcgccttcactggttccttcattggtttcggtggtggcggagcttccacgcgatcaccgagtttgtaggagaggttca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12835739 |
ccatttgtaaaaacttcaccgggcgccttcactggttccttcattgttttcggtggtggcgg---------gcgatcaccgagtttgtaggagaggttca |
12835829 |
T |
|
| Q |
105 |
aggtccctctggatttctctgagtttattttcctaacctgataactgagttggtggccggcagggttatcaaaaagttccttgagtgggataatgacggt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
12835830 |
aggtccctctggatttctctgagtttattttcctaacctgataactgagttggtggccggcagggttatcaaaaagttccttgagagggatattgacggt |
12835929 |
T |
|
| Q |
205 |
gccgatgagct |
215 |
Q |
| |
|
||| ||||||| |
|
|
| T |
12835930 |
gccaatgagct |
12835940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 77 - 210
Target Start/End: Original strand, 27155666 - 27155805
Alignment:
| Q |
77 |
cgatcaccgagtttgtaggagaggttcaaggtccctctggatttctctgagtttattttcctaacctgataactgagttggtggc------cggcagggt |
170 |
Q |
| |
|
|||||||| | ||||||||||||||| ||| | || |||||||| | ||| | ||||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
27155666 |
cgatcaccaaatttgtaggagaggtttaagctacccctggatttgtgagagggttttttcctaacctggtaactgagttggtggccagcagcagcagggt |
27155765 |
T |
|
| Q |
171 |
tatcaaaaagttccttgagtgggataatgacggtgccgat |
210 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||| |||||| |
|
|
| T |
27155766 |
tatcaagaagttccttgagagggatatagacggcgccgat |
27155805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 77 - 157
Target Start/End: Complemental strand, 15275756 - 15275676
Alignment:
| Q |
77 |
cgatcaccgagtttgtaggagaggttcaaggtccctctggatttctctgagtttattttcctaacctgataactgagttgg |
157 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||| || |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
15275756 |
cgatcaccaaatttgtaggagaggtttaaggtacccttggatttccgagagcgttttttcctaacctgataactgagttgg |
15275676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University