View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_27 (Length: 307)
Name: NF19270_low_27
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 1573031 - 1573301
Alignment:
| Q |
19 |
gagcccccacctgacattggttcaaaggatttccgcgatccaaccaccggttggatcgggccagatggaaaatggagagtcctaattggatcaaagaaag |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573031 |
gagcccccacctggcattggttcaaaggatttccgcgatccaaccactggttggatcgggccagatggaaaatggagagtcctaattggatcaaagaaag |
1573130 |
T |
 |
| Q |
119 |
gacaaacaggtctttcattggtttacaaaaccacaaattttataaattttgaactaaatgataactacttacatgcggttccgggtacgggtatgtggga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573131 |
gacaaacaggtctttcattggtttacaaaaccacaaattttataaattttgaactaaatgataactacttacatgcggttccgggtacgggtatgtggga |
1573230 |
T |
 |
| Q |
219 |
atgtgtggacttttacccggtttcaataaacgggtcaaatggtttggacacatcagtaaatggaccacatg |
289 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573231 |
atgtgtggatttttacccggtttctataaacgggtcaaatggtttggacacatcagtaaatggaccacatg |
1573301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University