View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19270_low_27 (Length: 307)

Name: NF19270_low_27
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19270_low_27
NF19270_low_27
[»] chr3 (1 HSPs)
chr3 (19-289)||(1573031-1573301)


Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 1573031 - 1573301
Alignment:
19 gagcccccacctgacattggttcaaaggatttccgcgatccaaccaccggttggatcgggccagatggaaaatggagagtcctaattggatcaaagaaag 118  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1573031 gagcccccacctggcattggttcaaaggatttccgcgatccaaccactggttggatcgggccagatggaaaatggagagtcctaattggatcaaagaaag 1573130  T
119 gacaaacaggtctttcattggtttacaaaaccacaaattttataaattttgaactaaatgataactacttacatgcggttccgggtacgggtatgtggga 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1573131 gacaaacaggtctttcattggtttacaaaaccacaaattttataaattttgaactaaatgataactacttacatgcggttccgggtacgggtatgtggga 1573230  T
219 atgtgtggacttttacccggtttcaataaacgggtcaaatggtttggacacatcagtaaatggaccacatg 289  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
1573231 atgtgtggatttttacccggtttctataaacgggtcaaatggtttggacacatcagtaaatggaccacatg 1573301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University