View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19270_low_31 (Length: 263)
Name: NF19270_low_31
Description: NF19270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19270_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 24 - 256
Target Start/End: Complemental strand, 49461472 - 49461240
Alignment:
| Q |
24 |
gcagtttgtctttattttgttttatcaaacgggtcatcatagattgagtgatcatcggttaaaaatgtatctgcatctttatttgaaaatccggagctca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
49461472 |
gcagtttgtctttattttgttttatcaaacgggtcatcatagattgagtgatcatcggttaaaaatgtatctgcatttttatttgaaaatccagagctca |
49461373 |
T |
|
| Q |
124 |
tgcatgattatagattctgggcaataatttattctcttgttggacttgggaatgtaagtttttgactataaaacttttaagaaagtcgctagaaatatca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49461372 |
tgcatgattatagattctgggcaataatttattctcttgttggacttgggaatgtaagtttttgactataaaacttttaagaaagtcgctagaaatatca |
49461273 |
T |
|
| Q |
224 |
acaacttaccaaacatttttgtgagaataatct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49461272 |
acaacttaccaaacatttttgtgagaataatct |
49461240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 198 - 242
Target Start/End: Complemental strand, 42175396 - 42175352
Alignment:
| Q |
198 |
ttttaagaaagtcgctagaaatatcaacaacttaccaaacatttt |
242 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
42175396 |
ttttaaggaagttgctagaaatatcaataacttcccaaacatttt |
42175352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University